Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 593

1 members and 592 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,916
Threads: 249,118
Posts: 2,572,200
Top Poster: JLC (31,651)
Welcome to our newest member, Wilson1885
Results 1 to 2 of 2
  1. #1
    Registered User Ballpythonguy92's Avatar
    Join Date
    11-20-2016
    Posts
    393
    Thanks
    214
    Thanked 115 Times in 91 Posts

    What is the difference between yellowbelly and nerds

    Hi I was wondering what is the difference between bling yellowbelly and yellowbelly if their is any be very helpful as I got a nerd line 4 super pastel and bling yellowbelly spider but it's 3 gene animal it is way better looking then most super pastel spider yellowbellys I've seen I really thought I had one picture I'll do a full update on him Lol late breeder or early starter

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    No difference. "Bling" is just the name NERD gave their line of YB. Same way RDR calls his YB line "Goblin"
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Stewart_Reptiles (07-24-2017),Thom Noble (07-29-2017)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1