» Site Navigation
1 members and 1,374 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,937
Threads: 249,129
Posts: 2,572,287
Top Poster: JLC (31,651)
|
-
Wow! I bet she will just get better and better with age!
-
-
Re: Ivory/Albino Paradox? Chimera? What is this thing?
 Originally Posted by nicolerc
I'm the operations manager at The Gourmet Rodent. We currently produce about 2500 clutches a year of ball pythons so are pretty accustomed to seeing new and strange things pop up, but this one probably takes the cake. This snake was produced from the following pairing:
Dam: Yellowbelly
Possible Sires: Fire Yellowbelly or Ivory
The dam's previous breeding record includes two previous clutches:
2012 bred to Fire
2013 bred to Desert Yellowbelly, Specter, and Enchi Spark
We initially thought some sort of paradox/chimerism due to a potentially unknown albino het, but that doesn't explain dark eyes on a seemingly albino head. If you look closely, the "white" sections show the ivory spine striping.
Any ideas?!
Nicole
Simply beautiful !
Sent from my iPad using Tapatalk
-
-
Re: Ivory/Albino Paradox? Chimera? What is this thing?
I don't know - but I want!
 No cage is too large - nature is the best template - a snoot can't be booped too much
-
-
-
-
Re: Ivory/Albino Paradox? Chimera? What is this thing?
Whoa almost has a pied affect too. So so cool.
Sent from my SM-G386T using Tapatalk
~Sunny~
Booplesnoop Coilsome, Odyn, & Eeden AKA theLittleOne
0:1 Pastel Het Red Day Chocolate
1:0 Normal
0:0:1 Pueblan milk snake
*~* Nothing sticky (tape, stick on gauges, Velcro) goes into your enclosure! Again...NOTHING sticky goes into your enclosure....EVER! *~*
-
-
So leucism and albinism are somewhat "related" with leucys having some pigment and retaining dark eyes. Is it possible that somehow one of the Leucy genes did it's thing but was missing or had an extra marker that allowed the orange to pop?
-
-
Re: Ivory/Albino Paradox? Chimera? What is this thing?
 Originally Posted by chakup
So leucism and albinism are somewhat "related" with leucys having some pigment and retaining dark eyes. Is it possible that somehow one of the Leucy genes did it's thing but was missing or had an extra marker that allowed the orange to pop?
Slight tangent but I've got a pair of brilliant white , Luicistic Texas Rat snakes but the female has red eyes and the male seems to have blue eyes ... What's going on there I wonder ?
-
-
Re: Ivory/Albino Paradox? Chimera? What is this thing?
This is crazy! I definitely see the ivory. Maybe it's the lighting but the eyes look darker than ivory eyes, which can look black but are a very dark blue with dark red pupils. Those eyes look more like super fire eyes to me. But the orange pattern on white looks like albino!
Any chance the dam could be fire too?
Last edited by greco; 07-22-2017 at 09:43 PM.
-
-
Re: Ivory/Albino Paradox? Chimera? What is this thing?
 Originally Posted by chakup
So leucism and albinism are somewhat "related" with leucys having some pigment and retaining dark eyes. Is it possible that somehow one of the Leucy genes did it's thing but was missing or had an extra marker that allowed the orange to pop?
Leucism and albinism are not particularly related; the prior is a dysfunction in the deposition of pigmentation (but all pigments are still produced) while the latter is a failure to produce the dark pigment, melanin. So this is not the result of a leucism gene going rogue.
 Originally Posted by nicolerc
It's possible there are hidden albino genes we aren't aware of but that still doesn't explain the dark eyes, which are the weirdest part of the whole thing for me.
For my money, what you have is a case where both parents were carrying the Albino allele and your animal is most likely a chimera. The Albino sections are AlbinoYB (which also accounts for the yellow head) and the Ivory portions are just that: Ivory. And the dark eyes are derived from them originating from Ivory lineage cells
 Originally Posted by nicolerc
Siblings are totally as expected: yellowbellies, ivories, etc
With regard to the siblings, was there Fire in any of them and/or were any of them WT? Just want to see if we can pin down who exactly dad was.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
wow it's beautiful! ISOWANTTHAT! Paradox/Chimera's are awesome! u guys at GR aer producing some unique animals: https://ball-pythons.net/forums/show...radox-Highway)
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|