» Site Navigation
0 members and 1,342 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,937
Threads: 249,130
Posts: 2,572,295
Top Poster: JLC (31,651)
|
-
Registered User
Mocha X Russo Not Compatable
I joined this site today to try and get an answer to a breeding I have been working on for 4-5yrs. Nobody has any pics on insite on this that I can find online.
I bred a Het Russo to a Mocha last year with 6 eggs and no bels. This year I did the same cross with a Mocha Male to a Het Russo female. Both from repital breeders and both proven. I got 8 eggs with no bels again. But both times I got a few with circle back patterns like a trick.
I know now that Lucy's can not be produced from this pairing but could the circle back ones be the supers or are these morphs not really on the same allele.
I can't figure how to attach pics but I would like to know if anyone has had the same results.
I do plan on breeding the babies to a lesser or mojave lucy to find out in the future .
-
-
Pictures of the parents will help immensley when you are able to upload them. Mocha and Het Russo are allelic, that is 100% confirmed based on what each of them are allelic too. I havent seen a russo x mocha cross but it will be an allelic combo and should produce some sort of "bel-super". What I think happened is either you are just missing the odds, or one of the snakes is not what you think it is.
-
-
http://www.worldofballpythons.com/morphs/lesser-mocha/
https://www.morphmarket.com/us/c/rep...-pythons/71181
there are allelic 100%, no doubts about it.
Given at least publicly the russo mocha hasn't been made. we have two options.
1. you had bad luck, you wouldn't be the first and won't be the last to have bad luck.
2. Theres a very slight chance the mocha russo isn't visual in the way we thought it would be. However given the patterns of every other BEL complex morph combo, I would very highly doubt it. If thats the case, some offpsring would make all russos and mochas (no normals).
-
The Following User Says Thank You to OhhWatALoser For This Useful Post:
PitOnTheProwl (07-02-2017)
-
Forgot to ask, can you post pictures of your circle back offspring?
-
-
Registered User
Re: Mocha X Russo Not Compatable
I think if a bel was possible it would have been done by now. It's too simple of a cross. I didn't beilive it you couldnt produce one either. That's why I wanted to work on this project. I know it's possible to hit bad odds two years in a row but everyone ? I bought my proven Russo from Rob Starzman last year and my proven Mocha male from Outback 2 years ago. My male has produced mochas gor me out of other females and i replaced him now with a mocha pin.
I do have pics but I can't figure how to add them. The picture icon just whites out the screen. Is there another way to add them.
-
-
Registered User
Re: Mocha X Russo Not Compatable
[IMG]20170701_215354[/IMG][IMG]20170701_215434[/IMG]
I think i figured it out. Not as easy as FB
These are the ones hatching now.
-
-
The pictures should be hosted somewhere like Photobucket and linked, or uploaded to your own gallery at https://ball-pythons.net/gallery//br...mageuser=69538.
Last edited by bcr229; 07-02-2017 at 05:43 PM.
-
-
Re: Mocha X Russo Not Compatable
 Originally Posted by Rasmussen
I know now that Lucy's can not be produced from this pairing
I am sorry but you cannot claim that assertion. These morphs are allelic. No ifs. No ands. No buts.
 Originally Posted by Rasmussen
It's too simple of a cross.
As for it being "too simple of a cross"... I know of people who have gone six years breeding het to het before getting a visual and that is just as much of simple cross.
 Originally Posted by Rasmussen
I think if a bel was possible it would have been done by now.
And maybe it has been and no one bothered to post pics because it is exactly what everyone figured it would be, a BluEL. Or, no one has done it because everyone knows it is just going to be a BluEL and the people with these morphs in their collections would rather direct their efforts elsewhere. Or, since Russo and Mocha seem to be just about the least represented alleles of the BluEL complex in the hobby, perhaps it is just that very few people have both in their collections to even try and, for those that do have both, see the previous point.
As everyone has said -- you either just had bad odds or one or the other of your animals is not what you think it is
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Mocha X Russo Not Compatable
14 eggs are insufficient. You need at least 17 eggs to get past the 1% level of significance. And more than 17 is better than only 17.
If those circle backs have a Russo gene paired with a mocha gene (which I will call het Russo/mocha), then breeding any of them to a normal ball python would be expected to produce 50% mocha and 50% het Russo babies. You might want to try such a mating. If any normal babies hatch, then the circle back parent is not a het Russo/mocha.
By the way, alleles are slightly different genes that can form a gene pair. A locus (plural = loci) is the location in the genome where a gene resides. So alleles have the same locus.
Good luck.
-
-
Registered User
Re: Mocha X Russo Not Compatable
Its not just my breeding. In 2015 I produced 2 Lucy's from mocha to mocha breeding (lattes) . At a show in WA here a couple guys came Up to my booth telling me about the Mocha russo issue so I looked it up and found nothing on it so I took my mocha female bought a russo male and tried it last year for myself and then tried a mocha male to a russo female this year.
I was hoping someone on here had some insite is why I posted on here. I read a post on here last fall where someone was going to try a super russo to a mocha.
I'm going to hold back one of the males that looks different and breed him to a super mojave female that I have next season. I'm just going to keep working on it. Also setting up a photobucket account.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|