Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,250

0 members and 1,250 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,937
Threads: 249,130
Posts: 2,572,295
Top Poster: JLC (31,651)
Welcome to our newest member, GeorgiaD182
Page 1 of 2 12 LastLast
Results 1 to 10 of 13
  1. #1
    Registered User
    Join Date
    07-01-2017
    Posts
    5
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Mocha X Russo Not Compatable

    I joined this site today to try and get an answer to a breeding I have been working on for 4-5yrs. Nobody has any pics on insite on this that I can find online.
    I bred a Het Russo to a Mocha last year with 6 eggs and no bels. This year I did the same cross with a Mocha Male to a Het Russo female. Both from repital breeders and both proven. I got 8 eggs with no bels again. But both times I got a few with circle back patterns like a trick.
    I know now that Lucy's can not be produced from this pairing but could the circle back ones be the supers or are these morphs not really on the same allele.
    I can't figure how to attach pics but I would like to know if anyone has had the same results.
    I do plan on breeding the babies to a lesser or mojave lucy to find out in the future .

  2. #2
    BPnet Veteran Seven-Thirty's Avatar
    Join Date
    01-28-2016
    Location
    Canada
    Posts
    410
    Thanks
    211
    Thanked 323 Times in 169 Posts
    Pictures of the parents will help immensley when you are able to upload them. Mocha and Het Russo are allelic, that is 100% confirmed based on what each of them are allelic too. I havent seen a russo x mocha cross but it will be an allelic combo and should produce some sort of "bel-super". What I think happened is either you are just missing the odds, or one of the snakes is not what you think it is.

  3. #3
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2
    http://www.worldofballpythons.com/morphs/lesser-mocha/
    https://www.morphmarket.com/us/c/rep...-pythons/71181
    there are allelic 100%, no doubts about it.

    Given at least publicly the russo mocha hasn't been made. we have two options.
    1. you had bad luck, you wouldn't be the first and won't be the last to have bad luck.
    2. Theres a very slight chance the mocha russo isn't visual in the way we thought it would be. However given the patterns of every other BEL complex morph combo, I would very highly doubt it. If thats the case, some offpsring would make all russos and mochas (no normals).

  4. The Following User Says Thank You to OhhWatALoser For This Useful Post:

    PitOnTheProwl (07-02-2017)

  5. #4
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2
    Forgot to ask, can you post pictures of your circle back offspring?

  6. #5
    Registered User
    Join Date
    07-01-2017
    Posts
    5
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Re: Mocha X Russo Not Compatable

    I think if a bel was possible it would have been done by now. It's too simple of a cross. I didn't beilive it you couldnt produce one either. That's why I wanted to work on this project. I know it's possible to hit bad odds two years in a row but everyone ? I bought my proven Russo from Rob Starzman last year and my proven Mocha male from Outback 2 years ago. My male has produced mochas gor me out of other females and i replaced him now with a mocha pin.

    I do have pics but I can't figure how to add them. The picture icon just whites out the screen. Is there another way to add them.

  7. #6
    Registered User
    Join Date
    07-01-2017
    Posts
    5
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Re: Mocha X Russo Not Compatable

    [IMG]20170701_215354[/IMG][IMG]20170701_215434[/IMG]
    I think i figured it out. Not as easy as FB
    These are the ones hatching now.

  8. #7
    Super Moderator bcr229's Avatar
    Join Date
    03-18-2013
    Location
    Eastern WV Panhandle
    Posts
    9,572
    Thanks
    2,977
    Thanked 10,009 Times in 4,841 Posts
    Images: 34
    The pictures should be hosted somewhere like Photobucket and linked, or uploaded to your own gallery at https://ball-pythons.net/gallery//br...mageuser=69538.
    Last edited by bcr229; 07-02-2017 at 05:43 PM.

  9. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Mocha X Russo Not Compatable

    Quote Originally Posted by Rasmussen View Post
    I know now that Lucy's can not be produced from this pairing
    I am sorry but you cannot claim that assertion. These morphs are allelic. No ifs. No ands. No buts.


    Quote Originally Posted by Rasmussen View Post
    It's too simple of a cross.
    As for it being "too simple of a cross"... I know of people who have gone six years breeding het to het before getting a visual and that is just as much of simple cross.


    Quote Originally Posted by Rasmussen View Post
    I think if a bel was possible it would have been done by now.
    And maybe it has been and no one bothered to post pics because it is exactly what everyone figured it would be, a BluEL. Or, no one has done it because everyone knows it is just going to be a BluEL and the people with these morphs in their collections would rather direct their efforts elsewhere. Or, since Russo and Mocha seem to be just about the least represented alleles of the BluEL complex in the hobby, perhaps it is just that very few people have both in their collections to even try and, for those that do have both, see the previous point.


    As everyone has said -- you either just had bad odds or one or the other of your animals is not what you think it is
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. #9
    BPnet Veteran
    Join Date
    08-31-2011
    Posts
    649
    Thanks
    193
    Thanked 428 Times in 263 Posts
    Images: 21

    Re: Mocha X Russo Not Compatable

    14 eggs are insufficient. You need at least 17 eggs to get past the 1% level of significance. And more than 17 is better than only 17.

    If those circle backs have a Russo gene paired with a mocha gene (which I will call het Russo/mocha), then breeding any of them to a normal ball python would be expected to produce 50% mocha and 50% het Russo babies. You might want to try such a mating. If any normal babies hatch, then the circle back parent is not a het Russo/mocha.

    By the way, alleles are slightly different genes that can form a gene pair. A locus (plural = loci) is the location in the genome where a gene resides. So alleles have the same locus.

    Good luck.

  11. #10
    Registered User
    Join Date
    07-01-2017
    Posts
    5
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Re: Mocha X Russo Not Compatable

    Its not just my breeding. In 2015 I produced 2 Lucy's from mocha to mocha breeding (lattes) . At a show in WA here a couple guys came Up to my booth telling me about the Mocha russo issue so I looked it up and found nothing on it so I took my mocha female bought a russo male and tried it last year for myself and then tried a mocha male to a russo female this year.
    I was hoping someone on here had some insite is why I posted on here. I read a post on here last fall where someone was going to try a super russo to a mocha.
    I'm going to hold back one of the males that looks different and breed him to a super mojave female that I have next season. I'm just going to keep working on it. Also setting up a photobucket account.

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1