Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,236

1 members and 1,235 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

» Stats

Members: 75,937
Threads: 249,130
Posts: 2,572,295
Top Poster: JLC (31,651)
Welcome to our newest member, GeorgiaD182
Page 4 of 4 FirstFirst 1234
Results 31 to 34 of 34

Thread: Spider breeding

  1. #31
    BPnet Veteran
    Join Date
    12-16-2015
    Location
    Illinois
    Posts
    488
    Thanks
    90
    Thanked 160 Times in 103 Posts
    Images: 2

    Re: Spider breeding

    Quote Originally Posted by DLena View Post
    I don't see where I ever specifically mentioned spider x spider. I am talking about any known pairing that routinely produces deformed offspring. My facts are accurate. I'm sorry that my presentation of them was too "rough draft" and created your misunderstanding.



    I know of four cases where SuperSpiders have left the egg (some of those may have been cut by the breeder, I never asked that detail) and I have rumors of three others that I have not been able to confirm. So they do, on very rare occasion, go full term. That said, every single one has died within hours.

    ...thank you.

    For me that statement was true. All my other females are unable to breed at this point, so for me it is true. Next season it will be differnt, but for now it is true.

    ...the ability to delay gratification is also a very important life lesson. What harm would there be to waiting until next year, when you could do a different pairing?

    respectfully submitted,
    Darlene
    i understand your personal opinion at the matter and can respect that. The statement of personal gratification seems way off base. She, and I, have waited three years to grow our snakes to appropriate size, so I think we know about delaying gratification. My question was always about the possibility off all other eggs being viable.

    On on that same token, if you breed ball pythons, what morphs? I am sure I can find more than 4 people who have had issues with those morphs that came out of the egg. I would honestly say with the thousands of times spiders have been paired if only 4 have ever made it out I find it extremely unlike to occur. If some eggs don't make it, so be it. That's natures way of dealing with things.

  2. #32
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2

    Re: Spider breeding

    Quote Originally Posted by asplundii View Post

    I know of four cases where SuperSpiders have left the egg (some of those may have been cut by the breeder, I never asked that detail) and I have rumors of three others that I have not been able to confirm. So they do, on very rare occasion, go full term. That said, every single one has died within hours.
    Fine there is no public record of them hatching. Only one I can see is Tom's and that egg obviously was ripped open. Given the rarity of it though, I still don't see it as significant. It would be really nice if others would go public with there info though.

    Dlena I go back and read and still see references as talking about spider x spider. If that's not the case we have a big misunderstanding, so I apologize.

  3. #33
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Spider breeding

    Quote Originally Posted by OhhWatALoser View Post
    Given the rarity of it though, I still don't see it as significant.
    A fair point I concede.


    Quote Originally Posted by OhhWatALoser View Post
    It would be really nice if others would go public with there info though.
    Well... Given how readily people in this hobby are to attack you if you say something that contradicts the word of one of the "leaders" in the hobby, it is not a terrible surprise that few people like to talk about these things in public. Heck... I have been saying the SuperSpider was terminal for nearly a decade and yet there is still a sizable portion of the hobby that refuses to accept the idea. You can only yell into the void for so long before it becomes tedious and you focus your efforts on other, more productive things


    Quote Originally Posted by OhhWatALoser View Post
    Dlena I go back and read and still see references as talking about spider x spider. If that's not the case we have a big misunderstanding, so I apologize.
    I think, perhaps, that you are confusing Dlena with the OP... ???
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. #34
    BPnet Senior Member rufretic's Avatar
    Join Date
    02-05-2017
    Posts
    1,224
    Thanks
    959
    Thanked 1,186 Times in 695 Posts
    Images: 11
    There is no good reason to do a spider x spider pairing. Why anyone would do a pairing that would produce guaranteed failures is beyond me when there are endless options. Just because you personally don't have another female available doesn't mean you should cut your losses and just do it anyway for the few that will survive. That would be considered very irresponsible breeding. You have plenty of other options. You could wait a year or you could choose from the many breeding ready females for sale right now if you need to breed right now. There is no excuse for pairing two snakes that will produce known failures.

Page 4 of 4 FirstFirst 1234

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1