» Site Navigation
0 members and 791 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,917
Threads: 249,118
Posts: 2,572,205
Top Poster: JLC (31,651)
Welcome to our newest member, Necbov
|
-
Re: Which morphs get better with age?
 Originally Posted by Deborah
Anything with Hypo, fire, YB, OD will generally age better, some enchi combos age well as well while some get very muddy depending on what the combo is.
Sent from my SM-G900V using Tapatalk
As always, thanks Deborah. Random side question: what does hidden gene woma do?
-
-
Re: Which morphs get better with age?
 Originally Posted by craigafrechette
As always, thanks Deborah. Random side question: what does hidden gene woma do?
I have no idea how they age on their own or in combos I don't work with those, I am busy enough with what I have lol
-
The Following User Says Thank You to Stewart_Reptiles For This Useful Post:
Craiga 01453 (05-19-2017)
-
Re: Which morphs get better with age?
 Originally Posted by craigafrechette
As always, thanks Deborah. Random side question: what does hidden gene woma do?
From what I've seen HGW tends to hold flaming and contrast pretty well, while the brightness of the colors fade a bit. This is just an observation of others snakes though, I don't own HGW personally though it's definitely on my list. The breeder HGW yellowbellies and HGW fires I've had the privilege of seeing in person have all been very attractive for their size/age, imo. But there is high and low quality to everything.
-
The Following User Says Thank You to Trisnake For This Useful Post:
Craiga 01453 (05-21-2017)
-
Re: Which morphs get better with age?
 Originally Posted by Deborah
Anything with ... fire, YB, OD will generally age better
I will agree that combos with these morphs tend to age well but the single genes of each are not terribly impressive as they age. And if you can get a combo with all three of those morphs... WOW!
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
Craiga 01453 (05-22-2017)
-
Re: Which morphs get better with age?
 Originally Posted by craigafrechette
As always, thanks Deborah. Random side question: what does hidden gene woma do?
I have an inferno female that surprises me with each shed, she looks just as good if not better than when I got her. In all fairness she is only 400 grams though so it's too early to say for sure but I have definitely seen other morphs going down hill by this size so she's off to a good start, only time will tell if she holds this pretty into adulthood. As for hgw by itself, I have no experience with it.
Others that have held color well for me are:
enchi pastel 900g
killerbee 800g
nuclear enchi 1000g
bumble belly 1800g
pastel desert ghost 1100g by far my favorite! After each shed she looks just as clean and bright as ever! Desert ghost is an amazing morph, in combo it will make any other morph look amazing. I can't believe more people aren't working with it. I have big plans for this girl.
I've been very lucky with all my choices so far, I've only had a couple dull with age so far but I still have quite a few that are too young to tell but I have high hopes because most combos that are still growing out have fire, enchi and OD in the mix so I think my odds are good.
-
The Following User Says Thank You to rufretic For This Useful Post:
Craiga 01453 (05-22-2017)
-
Normal
So rare that it should be a morph now, right?...
Last edited by ringorock; 05-22-2017 at 10:56 AM.
-
The Following 2 Users Say Thank You to ringorock For This Useful Post:
Craiga 01453 (05-22-2017),JodanOrNoDan (05-22-2017)
-
Re: Which morphs get better with age?
 Originally Posted by ringorock
Normal
So rare that it should be a morph now, right?...
Yup, normals pretty much stay the same. A good normal is still worth as much to me as most single gene animals. People often forget that there are two genes passed to offspring. If one of those genes is actually the "normal" version, it is just as important as the "morph".
-
The Following User Says Thank You to JodanOrNoDan For This Useful Post:
Craiga 01453 (05-22-2017)
-
Leopards don't really change much as they age, just a nice dark snake with a bright pattern. GHIs too.
I think in combos vanilla has been a sort of underrated gene, or at least I don't hear much about it very often. My pastel vanilla girl is getting close to 800g and still super bright yellow. I always think she's starting to brown out when she gets close to a shed cycle, but then as soon as she's shed BAM! Glowing bright beautiful snake.
Last edited by Lizardlicks; 05-22-2017 at 12:04 PM.
-
The Following User Says Thank You to Lizardlicks For This Useful Post:
Craiga 01453 (05-22-2017)
-
Re: Which morphs get better with age?
 Originally Posted by Lizardlicks
Leopards don't really change much as they age, just a nice dark snake with a bright pattern. GHIs too.
I think in combos vanilla has been a sort of underrated gene, or at least I don't hear much about it very often. My pastel vanilla girl is getting close to 800g and still super bright yellow. I always think she's starting to brown out when she gets close to a shed cycle, but then as soon as she's shed BAM! Glowing bright beautiful snake.
I've been patiently waiting to read a reply like this about vanillas. My boy Tyson is a vanilla het pied. He's just barely pushing 300 grams still, but man, he looks better with each shed. His colors seem to pop a little more with each shed and his blushing just seems to get prettier.
But maybe I'm a bit biased?
-
The Following User Says Thank You to Craiga 01453 For This Useful Post:
-
Re: Which morphs get better with age?
 Originally Posted by Deborah
I have no idea how they age on their own or in combos I don't work with those, I am busy enough with what I have lol
I should have worded my question better. I appreciate your answer and would have asked about how they age as a follow-up question.
But what I was curious about is the gene itself. What does hidden gene woma do to the colors/patterns of the BP? And why is it called "hidden gene" woma?
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|