Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,831

1 members and 1,830 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,049
Threads: 249,210
Posts: 2,572,712
Top Poster: JLC (31,651)
Welcome to our newest member, Mikvik
Results 1 to 2 of 2
  1. #1
    BPnet Veteran Oxylepy's Avatar
    Join Date
    10-25-2008
    Location
    Pittsburgh Pennsylvania
    Posts
    2,383
    Thanks
    362
    Thanked 573 Times in 434 Posts

    What colorations exist within ball pythons?

    Ball pythons have extreme genetic variation within them, which is a very interesting trait among animals. However it is unlikely that the scientific community will take them up because it is unlikely to be profitable or useful, not to mention the time it takes to study them over generations (they aren't very quick for breeding out and studying).

    This leaves the task of studying ball pythons up to the community. OWAL has collected a lot of useful information, however there is a lot more out there that could be gathered to help better understand the species we love.

    So, I bring this before the community, can we compile a useful list of color information on ball pythons?

    The goal is to get together a number of base colorations and how those interact to produce other colors.
    Ball Pythons 1.1 Lesser, Pastel
    1.0 Lesser Pastel, 0.0.7 mixed babies

  2. The Following 2 Users Say Thank You to Oxylepy For This Useful Post:

    embrit345 (05-14-2017),Ronniex2 (05-13-2017)

  3. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    There are only two pigment types in balls: melanin and some variant(s) of pteridine. So the only colours we will see are variants of brown and yellow/orange
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1