» Site Navigation
1 members and 674 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,945
Threads: 249,139
Posts: 2,572,328
Top Poster: JLC (31,651)
|
-
BPnet Veteran
Re: Type of ghost
The pics are a week old. They get cleaned twice a day. But thank you for looking out
Sent from my LGLS775 using Tapatalk
-
-
BPnet Veteran
Re: Type of ghost
Still doing research. Possible yellow ghost?
Sent from my LGLS775 using Tapatalk
-
-
Loco,
"Yellow", "Orange", "Butterscotch", "Peach", "Green", "Bell", and "NERD" lines of Hypo have all been proven compatible. So, if these girls have been bred to "Orange"-line and there were no visuals then they are likewise not going to be any of the others I listed.
Graziani had two lines of Hypo that were non-compatible with the standard lines; G1 and G2. You claim these are not G1 because of pattern but that is not a determinant. You have to breed to another G1 to determine whether or not they are compatible.
Also, GulfCoast Reptiles had a Hypo line that proved to be non-compatible with the standard lines. Again, you would have to breed to an animal in this line to determine whether yours is compatible.
Looking at pictures alone will not tell you anything. You will have to breed them out, it is as simple as that
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
BPnet Veteran
Re: Type of ghost
I talked to Graziani and he told me pattern does not match his line. Vespers led me to the yellow ghost. And at this moment the searches on yellow ghost matches my girl. I have a spider from her first clutch(sold as honeybee,old threads around still I believe). And I have her complete clutch from last season which was just an enchi and butter. First clutch was with honeybee (hypo spider). Last clutch was butter enchi orange ghost. No visuals. Both breedings were incompatible.
Sent from my LGLS775 using Tapatalk
-
-
Re: Type of ghost
 Originally Posted by locolobito
Vespers led me to the yellow ghost. And at this moment the searches on yellow ghost matches my girl.
And yet YellowGhost is compatible with OrangeGhost and so we can say for a fact that, regardless of whatever pictures you are looking at, your animal is not a YellowGhost because when bred to an OrangeGhost you did not get visuals
 Originally Posted by locolobito
I talked to Graziani and he told me pattern does not match his line.
While I have much respect for Greg he does occasionally make mistakes. The pattern in balls is widely variable and so a G1 from someone else's collection that had been out crossed could very likely have patterning different from the animals in Greg's collection.
So again, if you want to truly determine just what type of Hypo you have you are going to have to test by breeding. We can eliminate the most common lines of Hypo (Orange, Yellow, Peach, Butterscotch, Green, Bell, NERD, etc.) because they are all compatible. That leaves you with G1, G2 and GCR
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
PokeyTheNinja (04-26-2017)
-
BPnet Veteran
Re: Type of ghost
Cannot find anything on a G2 or GCR.
Sent from my LGLS775 using Tapatalk
-
-
Re: Type of ghost
 Originally Posted by locolobito
Cannot find anything on a G2 or GCR.
G2 was a Graziani line. Not sure if or how many he may have released but my guess is they are pretty rare.
GCR is Gulf Coast Reptiles. I believe that it may also have gone under the moniker of "Citrus Ghost" There should be plenty of information on them because people were upset a few years back when it came out that GCR had been selling their line and telling people it was compatible but breedings were proving that to not be true.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
BPnet Veteran
Re: Type of ghost
Thought I was going somewhere with my searches n what not. I'm giving up on ghost gene. About give up on hobby as a whole.
Sent from my LGLS775 using Tapatalk
-
-
BPnet Veteran
Re: Type of ghost
Wife agrees, snake hobby hasxto go. I'm getting way too stressed. Worse than before. Hobby is done. Thank you all for info and help.
Sent from my LGLS775 using Tapatalk
-
-
Re: Type of ghost
 Originally Posted by locolobito
Wife agrees, snake hobby hasxto go. I'm getting way too stressed. Worse than before. Hobby is done. Thank you all for info and help.
Sent from my LGLS775 using Tapatalk
Wow this all seems rather sudden !!
Surely it's worth just taking a breather and simply enjoy the snakes you have already .... I use my snakes as a way of relaxing or DE- stressing !
I have never been interested in breeding as you seem/seemed to be though .... mine are all display animals in vivs and all but one or three tolerate handling 
Please don't sell up and quit before giving the matter a lot more thought . You seem to have invested so much time and effort into your hobby !!!
Sent from my iPad using Tapatalk
-
The Following 2 Users Say Thank You to Zincubus For This Useful Post:
locolobito (04-27-2017),PokeyTheNinja (04-27-2017)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|