» Site Navigation
0 members and 564 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,912
Threads: 249,117
Posts: 2,572,189
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
Updated morph issues list
Not much to add from a few years ago. If any thing is added it will be here: http://www.owalreptiles.com/issues.php
Morph |
Issue |
Spider |
Wobble |
Woma |
Wobble |
Hidden Gene Woma |
Wobble |
Champagne |
Wobble |
Super Sable |
Wobble |
Powerball |
Wobble |
Black Head x Spider |
Masks the Spider's wobble |
Sable x Spider |
Difficult to hatch, severe wobble |
Champagne x Hidden Gene Woma |
Severe wobble |
Champagne x Spider |
Lethal |
Pearl |
Normally Lethal |
Super Champagne |
Lethal |
Super Spider |
Lethal |
Desert |
Female fertility issues |
Caramel Albino |
Kinking and female sub-fertility |
Super Cinnamon/Super Black Pastel |
Duckbill & rare kinking |
Super Lesser Platinum/Super Butter |
Bug eyes |
Lesser Platinum x Piedbald |
Small Eyes |
Banana/Coral Glow |
Males produce weird sex ratios |
anyone have anything to add or look into?
-
The Following 5 Users Say Thank You to OhhWatALoser For This Useful Post:
Craiga 01453 (04-21-2017),J880011 (04-21-2017),JodanOrNoDan (04-10-2017),MissterDog (04-21-2017),rufretic (04-10-2017)
-
Thank you sir, you are definitely the go to guy for this type of stuff.
-
-
I believe hidden gene woma creates a lethal super.
-
-
Re: Updated morph issues list
 Originally Posted by rufretic
I believe hidden gene woma creates a lethal super.
yup, thats the pearl
-
The Following User Says Thank You to OhhWatALoser For This Useful Post:
-
Re: Updated morph issues list
 Originally Posted by OhhWatALoser
[td]Lesser Platinum x Piedbald[/td]
[td]Small Eyes[/td]
It seems that most of the hetBluELs have a likelihood of microphthalmia that is inversely proportional to the strength of the hetBluEL gene (e.g., common in LesserPied, occasional in MojavePied, infrequent in SpecialPied). And so far every BluELPied I have seen has (not surprisingly) had microphthalmia.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Updated morph issues list
 Originally Posted by asplundii
It seems that most of the hetBluELs have a likelihood of microphthalmia that is inversely proportional to the strength of the hetBluEL gene (e.g., common in LesserPied, occasional in MojavePied, infrequent in SpecialPied). And so far every BluELPied I have seen has (not surprisingly) had microphthalmia.
Never really thought about it but, when I think back that's held true. Very interesting observation. I guess my next question would be does this also come into play with super lessers, as sometimes they have bug eyes or is it a different condition as the eye appear to be bigger and not smaller.
-
-
Re: Updated morph issues list
 Originally Posted by OhhWatALoser
I guess my next question would be does this also come into play with super lessers, as sometimes they have bug eyes or is it a different condition as the eye appear to be bigger and not smaller.
I am sure there is an interaction happening in both mutations that revolves around the eye development pathway. That said, I do not know where exactly in that pathway the two mutations are interacting
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Updated morph issues list
I can contribute Scroll down a bit on this page and look up what it says about super cypress. (It's with the picture of the super and the super Mojave Combo) https://m.facebook.com/RobinsonsRoyalPythons/
Sent from my iPhone using Tapatalk
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|