Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 623

1 members and 622 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,909
Threads: 249,113
Posts: 2,572,172
Top Poster: JLC (31,651)
Welcome to our newest member, KoreyBuchanan
Page 2 of 3 FirstFirst 123 LastLast
Results 11 to 20 of 23

Thread: Type of ghost

  1. #11
    BPnet Veteran
    Join Date
    09-09-2015
    Posts
    524
    Thanks
    277
    Thanked 148 Times in 104 Posts

    Re: Type of ghost

    The pics are a week old. They get cleaned twice a day. But thank you for looking out

    Sent from my LGLS775 using Tapatalk

  2. #12
    BPnet Veteran
    Join Date
    09-09-2015
    Posts
    524
    Thanks
    277
    Thanked 148 Times in 104 Posts

    Re: Type of ghost

    Still doing research. Possible yellow ghost?

    Sent from my LGLS775 using Tapatalk

  3. #13
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Loco,

    "Yellow", "Orange", "Butterscotch", "Peach", "Green", "Bell", and "NERD" lines of Hypo have all been proven compatible. So, if these girls have been bred to "Orange"-line and there were no visuals then they are likewise not going to be any of the others I listed.

    Graziani had two lines of Hypo that were non-compatible with the standard lines; G1 and G2. You claim these are not G1 because of pattern but that is not a determinant. You have to breed to another G1 to determine whether or not they are compatible.

    Also, GulfCoast Reptiles had a Hypo line that proved to be non-compatible with the standard lines. Again, you would have to breed to an animal in this line to determine whether yours is compatible.


    Looking at pictures alone will not tell you anything. You will have to breed them out, it is as simple as that
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. The Following User Says Thank You to asplundii For This Useful Post:

    locolobito (04-19-2017)

  5. #14
    BPnet Veteran
    Join Date
    09-09-2015
    Posts
    524
    Thanks
    277
    Thanked 148 Times in 104 Posts

    Re: Type of ghost

    I talked to Graziani and he told me pattern does not match his line. Vespers led me to the yellow ghost. And at this moment the searches on yellow ghost matches my girl. I have a spider from her first clutch(sold as honeybee,old threads around still I believe). And I have her complete clutch from last season which was just an enchi and butter. First clutch was with honeybee (hypo spider). Last clutch was butter enchi orange ghost. No visuals. Both breedings were incompatible.

    Sent from my LGLS775 using Tapatalk

  6. #15
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Type of ghost

    Quote Originally Posted by locolobito View Post
    Vespers led me to the yellow ghost. And at this moment the searches on yellow ghost matches my girl.
    And yet YellowGhost is compatible with OrangeGhost and so we can say for a fact that, regardless of whatever pictures you are looking at, your animal is not a YellowGhost because when bred to an OrangeGhost you did not get visuals

    Quote Originally Posted by locolobito View Post
    I talked to Graziani and he told me pattern does not match his line.
    While I have much respect for Greg he does occasionally make mistakes. The pattern in balls is widely variable and so a G1 from someone else's collection that had been out crossed could very likely have patterning different from the animals in Greg's collection.


    So again, if you want to truly determine just what type of Hypo you have you are going to have to test by breeding. We can eliminate the most common lines of Hypo (Orange, Yellow, Peach, Butterscotch, Green, Bell, NERD, etc.) because they are all compatible. That leaves you with G1, G2 and GCR
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. The Following User Says Thank You to asplundii For This Useful Post:

    PokeyTheNinja (04-26-2017)

  8. #16
    BPnet Veteran
    Join Date
    09-09-2015
    Posts
    524
    Thanks
    277
    Thanked 148 Times in 104 Posts

    Re: Type of ghost

    Cannot find anything on a G2 or GCR.

    Sent from my LGLS775 using Tapatalk

  9. #17
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Type of ghost

    Quote Originally Posted by locolobito View Post
    Cannot find anything on a G2 or GCR.
    G2 was a Graziani line. Not sure if or how many he may have released but my guess is they are pretty rare.

    GCR is Gulf Coast Reptiles. I believe that it may also have gone under the moniker of "Citrus Ghost" There should be plenty of information on them because people were upset a few years back when it came out that GCR had been selling their line and telling people it was compatible but breedings were proving that to not be true.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. The Following User Says Thank You to asplundii For This Useful Post:

    locolobito (04-25-2017)

  11. #18
    BPnet Veteran
    Join Date
    09-09-2015
    Posts
    524
    Thanks
    277
    Thanked 148 Times in 104 Posts

    Re: Type of ghost

    Thought I was going somewhere with my searches n what not. I'm giving up on ghost gene. About give up on hobby as a whole.

    Sent from my LGLS775 using Tapatalk

  12. #19
    BPnet Veteran
    Join Date
    09-09-2015
    Posts
    524
    Thanks
    277
    Thanked 148 Times in 104 Posts

    Re: Type of ghost

    Wife agrees, snake hobby hasxto go. I'm getting way too stressed. Worse than before. Hobby is done. Thank you all for info and help.

    Sent from my LGLS775 using Tapatalk

  13. #20
    BPnet Royalty Zincubus's Avatar
    Join Date
    02-22-2011
    Posts
    7,008
    Thanks
    2,526
    Thanked 4,965 Times in 3,027 Posts

    Re: Type of ghost

    Quote Originally Posted by locolobito View Post
    Wife agrees, snake hobby hasxto go. I'm getting way too stressed. Worse than before. Hobby is done. Thank you all for info and help.

    Sent from my LGLS775 using Tapatalk
    Wow this all seems rather sudden !!

    Surely it's worth just taking a breather and simply enjoy the snakes you have already .... I use my snakes as a way of relaxing or DE- stressing !

    I have never been interested in breeding as you seem/seemed to be though .... mine are all display animals in vivs and all but one or three tolerate handling

    Please don't sell up and quit before giving the matter a lot more thought . You seem to have invested so much time and effort into your hobby !!!


    Sent from my iPad using Tapatalk




  14. The Following 2 Users Say Thank You to Zincubus For This Useful Post:

    locolobito (04-27-2017),PokeyTheNinja (04-27-2017)

Page 2 of 3 FirstFirst 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1