» Site Navigation
0 members and 1,961 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,049
Threads: 249,209
Posts: 2,572,709
Top Poster: JLC (31,651)
Welcome to our newest member, Mikvik
|
-
Registered User
Champagne Ringers???
Just out of interest I was wondering if anyone knew what the deal with the champagne gene is??(haha)
I love the look of champagnes, especially the ones that possess ringers (white patches on the tail). But I'm curious as to how to make these ringer animals, do some just happen by chance to have ringers because the parent champagne had them or do they just happen randomly? As in, if I bought a female champagne without a ringer, could she potentially have offspring with ringers or is this not possible? I've not been able to find any answers about this on any other forums
thanks in advance
-
-
Champagne het pied can give you ringers up to an animal that is basically a champagne pied. An actual champagne pied strangely enough is white. I've also read somewhere about fire mixed into champagne giving a slightly greater chance at ringers but I don't know how true that is.
-
The Following User Says Thank You to salt For This Useful Post:
-
Fire, Cinnamon, and Black Pastel tend to throw ringers in Champagne. Not guaranteed though.
-
The Following User Says Thank You to Seven-Thirty For This Useful Post:
-
-
-
-
The Following User Says Thank You to Ba11er For This Useful Post:
-
Registered User
-
-
I'm thinking that just about anything mixed with Champagne has the potential to give a ringer. I'm betting that a normal single gene champagne with a ringer is het for something or has something else in the mix, I doubt that a single gene champagne will throw a ringer.
-
-
Re: Champagne Ringers???
Cinnamon champ is nice 
Sent from my SM-G935T using Tapatalk
-
-
Re: Champagne Ringers???
 Originally Posted by cchardwick
I'm betting that a normal single gene champagne with a ringer is het for something or has something else in the mix, I doubt that a single gene champagne will throw a ringer.
Straight Champs with no other genes will throw ringers, it a secondary phenotype that is tied in to the mutation.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|