» Site Navigation
3 members and 1,389 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,934
Threads: 249,128
Posts: 2,572,280
Top Poster: JLC (31,651)
|
-
Registered User
I just got this little girl a few months ago, and I'm trying to figure out what morph
Just trying to figure out what she is, I originally thought Acid, but now I'm leaning more towards a Het Caramel

Sent from my iPhone using Tapatalk
Last edited by lonelycrouton; 04-16-2017 at 11:13 PM.
-
-
Re: I just got this little girl a few months ago, and I'm trying to figure out what m
-
-
Re: I just got this little girl a few months ago, and I'm trying to figure out what m
Also should say hets are not visual. That can slightly be argued. Not seeing Acid. What was she sold as?
-
The Following User Says Thank You to PokeyTheNinja For This Useful Post:
-
-
The Following 3 Users Say Thank You to Seven-Thirty For This Useful Post:
dr del (04-17-2017),Foschi Exotic Serpents (04-17-2017),steph.tessy (04-24-2017)
-
In the case of a het Caramel Albino, yes it is not visible. Some of the most common morphs are hets, like Pastels.
It looks like Acids have a lot of belly markings. Check the belly
Ball Pythons 1.1 Lesser, Pastel
1.0 Lesser Pastel, 0.0.7 mixed babies
-
-
Registered User
I just got this little girl a few months ago, and I'm trying to figure out what morph
She was just sold as a "fancy" I got her from a pet store. Het caramel was just the closest thing I could find to her just googling it. She doesn't have many markings on her belly, I'll post a picture when I can. She's most likely an Enchi, she has the patterning, it's just her colors that seem "off"
Last edited by lonelycrouton; 04-17-2017 at 08:13 AM.
-
-
looks like an enchi chocolate to me
-
-
Registered User
Re: I just got this little girl a few months ago, and I'm trying to figure out what m
-
-
I can tell you straight off that it is not an Acid. The originator of that gene only sold animals to one person last year so there is no way you would find that morph in a pet store.
It looks like it could possibly be an Enchi but all things equal it is a NUPO
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
Dezoruba (04-17-2017),PokeyTheNinja (04-17-2017)
-
Those are enchi like belly markings. Lower alien head color says enchi. I can't see well enough in the picture to see if the eyes are right. Banding is a little weak to be enchi. Overall color is a off. If it is enchi there is something else there too and it is not a gene I am personally experienced with.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|