» Site Navigation
0 members and 652 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,909
Threads: 249,113
Posts: 2,572,172
Top Poster: JLC (31,651)
|
-
Re: Enchi Lesser/Butter Combos
 Originally Posted by Sargentnoid
[IMG]  [/IMG]
[IMG]  [/IMG]
Spider butter (possibly somthing else)
That is a really clean Bee
 Originally Posted by Deborah
The girls are looking even better now, you did a great job with them Bill, can' wait to see what they will produce in a few years.
Thanks Deborah. I couldn't be happier with the results and looks of this clutch. I have a feeling the Enchi Lesser Hypo girl may have a date with an Enchi het Clown het Ghost boy in the future.
 Originally Posted by zina10
Just a pastel lesser girl 
Just? She's quite nice.
 Originally Posted by embrit345
A very uncomfortable lesser xx
Sent from my iPhone using Tapatalk
Indeed! Is she gravid?
 Originally Posted by embrit345
And Jeffrey the dufus butter pastel poss het ghost tree Python lol xx
Sent from my iPhone using Tapatalk
Cool!
 Originally Posted by Alexiel03
Here are all of the lesser/butter, Enchi combos I have
Female Lesser
Male lemon pastel Enchi
Male Banana Pastel Enchi
Male butter pastel
Sent from my LGL39C using Tapatalk
Really nice group!
 Originally Posted by asplundii
Another really nice group of animals.
 Originally Posted by Deborah
As for my contribution I won't post all the enchi or lesser combos I have hatched over the years but I will post 2, the difference between those two is only one gene
3 Genes animal
4 Genes animal

Beautiful Deborah. The Leopard really adds to the combo.
Thanks everyone for posting all of your pictures. Let's keep them coming?
-
The Following User Says Thank You to rlditmars For This Useful Post:
-
Re: Enchi Lesser/Butter Combos
 Originally Posted by kxr
Those two in the second pic have lesser/butter? Awesome animals!
Nope, those two are just Enchi combos. And the third and fourth are Butter combos sans Enchi.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Hypo Butter Enchi
Visit Bradbury Ball Pythons on Facebook and Instagram!
-
The Following User Says Thank You to artist&writer For This Useful Post:
-
Re: Enchi Lesser/Butter Combos
 Originally Posted by rlditmars
Indeed! Is she gravid?
She most certainly is sweetie, due around 7th April xx
Sent from my iPhone using Tapatalk
-
The Following User Says Thank You to embrit345 For This Useful Post:
-
Re: Enchi Lesser/Butter Combos
 Originally Posted by artist&writer
Hypo Butter Enchi

Very Nice! How old is he and what does he weigh now?
 Originally Posted by embrit345
She most certainly is sweetie, due around 7th April xx
Sent from my iPhone using Tapatalk
Congrats! Looking forward to seeing some pictures of the clutch when she drops. Best of luck.
-
The Following User Says Thank You to rlditmars For This Useful Post:
-
Re: Enchi Lesser/Butter Combos
[QUOTE=rlditmars;2521412]Very Nice! How old is he and what does he weigh now?
He's around 700 grams. Proven breeder as his daughters hatched out in Sept. '15. I bought him in Oct. '13. I took that pic just about two weeks ago, so it is recent.
Visit Bradbury Ball Pythons on Facebook and Instagram!
-
The Following User Says Thank You to artist&writer For This Useful Post:
-
Re: Enchi Lesser/Butter Combos
 Originally Posted by OTorresUSMC
Supposed to be a pastel/butter/ghost. I say supposed to because i bought him at PetSmart(i know i know stupid move) as a Female. Well after some months I popped him and oh guess what was staring me in the face, yep hemipenes. So who knows what else they got wrong lol
Sent from my SM-G935V using Tapatalk
I'm no expert but I'd say that could be a pastel butter ghost. It's definitely more then a butter. To me it looks like a butter ghost + something else and that something else could easily be pastel.
Sent from my iPhone using Tapatalk
-
The Following User Says Thank You to kxr For This Useful Post:
-
Registered User
As for butter, my project for the upcoming season will be butter x butter and as a backup spider x butter. I have got also an enchi x lesser x pastel that will be bred to a normal and after will combine them with butter. Also pinstripe will be added in near future. Im dedicated to butter cause that was my first bp morph.
-
The Following User Says Thank You to Cybred For This Useful Post:
-
Re: Enchi Lesser/Butter Combos
Took a group shot today outside of my combos. A couple of the girls are bashful. Thanks for looking.
[IMG] [/IMG]
[IMG] [/IMG]
Last edited by rlditmars; 04-12-2017 at 01:11 PM.
-
The Following User Says Thank You to rlditmars For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|