Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 709

0 members and 709 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,909
Threads: 249,113
Posts: 2,572,174
Top Poster: JLC (31,651)
Welcome to our newest member, KoreyBuchanan
Page 3 of 3 FirstFirst 123
Results 21 to 29 of 29
  1. #21
    BPnet Lifer rlditmars's Avatar
    Join Date
    05-05-2012
    Posts
    2,964
    Thanks
    1,751
    Thanked 2,884 Times in 1,505 Posts

    Re: Enchi Lesser/Butter Combos

    Quote Originally Posted by Sargentnoid View Post
    [IMG][/IMG]

    [IMG][/IMG]

    Spider butter (possibly somthing else)
    That is a really clean Bee

    Quote Originally Posted by Deborah View Post
    The girls are looking even better now, you did a great job with them Bill, can' wait to see what they will produce in a few years.
    Thanks Deborah. I couldn't be happier with the results and looks of this clutch. I have a feeling the Enchi Lesser Hypo girl may have a date with an Enchi het Clown het Ghost boy in the future.

    Quote Originally Posted by zina10 View Post



    Just a pastel lesser girl
    Just? She's quite nice.

    Quote Originally Posted by embrit345 View Post


    A very uncomfortable lesser xx

    Sent from my iPhone using Tapatalk
    Indeed! Is she gravid?

    Quote Originally Posted by embrit345 View Post


    And Jeffrey the dufus butter pastel poss het ghost tree Python lol xx


    Sent from my iPhone using Tapatalk
    Cool!

    Quote Originally Posted by Alexiel03 View Post
    Here are all of the lesser/butter, Enchi combos I have

    Female Lesser


    Male lemon pastel Enchi


    Male Banana Pastel Enchi


    Male butter pastel


    Sent from my LGL39C using Tapatalk
    Really nice group!

    Quote Originally Posted by asplundii View Post








    Another really nice group of animals.

    Quote Originally Posted by Deborah View Post
    As for my contribution I won't post all the enchi or lesser combos I have hatched over the years but I will post 2, the difference between those two is only one gene

    3 Genes animal



    4 Genes animal

    Beautiful Deborah. The Leopard really adds to the combo.


    Thanks everyone for posting all of your pictures. Let's keep them coming?

  2. The Following User Says Thank You to rlditmars For This Useful Post:

    Stewart_Reptiles (03-22-2017)

  3. #22
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Enchi Lesser/Butter Combos

    Quote Originally Posted by kxr View Post
    Those two in the second pic have lesser/butter? Awesome animals!
    Nope, those two are just Enchi combos. And the third and fourth are Butter combos sans Enchi.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. #23
    BPnet Veteran artist&writer's Avatar
    Join Date
    05-20-2009
    Location
    Lexington, KY
    Posts
    520
    Thanks
    529
    Thanked 463 Times in 205 Posts
    Hypo Butter Enchi

    Visit Bradbury Ball Pythons on Facebook and Instagram!

  5. The Following User Says Thank You to artist&writer For This Useful Post:

    rlditmars (03-29-2017)

  6. #24
    Registered User
    Join Date
    03-28-2016
    Posts
    301
    Thanks
    474
    Thanked 208 Times in 104 Posts

    Re: Enchi Lesser/Butter Combos

    Quote Originally Posted by rlditmars View Post

    Indeed! Is she gravid?
    She most certainly is sweetie, due around 7th April xx


    Sent from my iPhone using Tapatalk
    Balls balls balls

  7. The Following User Says Thank You to embrit345 For This Useful Post:

    rlditmars (03-29-2017)

  8. #25
    BPnet Lifer rlditmars's Avatar
    Join Date
    05-05-2012
    Posts
    2,964
    Thanks
    1,751
    Thanked 2,884 Times in 1,505 Posts

    Re: Enchi Lesser/Butter Combos

    Quote Originally Posted by artist&writer View Post
    Hypo Butter Enchi

    Very Nice! How old is he and what does he weigh now?

    Quote Originally Posted by embrit345 View Post
    She most certainly is sweetie, due around 7th April xx


    Sent from my iPhone using Tapatalk
    Congrats! Looking forward to seeing some pictures of the clutch when she drops. Best of luck.

  9. The Following User Says Thank You to rlditmars For This Useful Post:

    embrit345 (03-30-2017)

  10. #26
    BPnet Veteran artist&writer's Avatar
    Join Date
    05-20-2009
    Location
    Lexington, KY
    Posts
    520
    Thanks
    529
    Thanked 463 Times in 205 Posts

    Re: Enchi Lesser/Butter Combos

    [QUOTE=rlditmars;2521412]Very Nice! How old is he and what does he weigh now?



    He's around 700 grams. Proven breeder as his daughters hatched out in Sept. '15. I bought him in Oct. '13. I took that pic just about two weeks ago, so it is recent.
    Visit Bradbury Ball Pythons on Facebook and Instagram!

  11. The Following User Says Thank You to artist&writer For This Useful Post:

    rlditmars (03-30-2017)

  12. #27
    BPnet Veteran kxr's Avatar
    Join Date
    12-01-2014
    Location
    Ontario, Canada
    Posts
    740
    Thanks
    414
    Thanked 462 Times in 329 Posts

    Re: Enchi Lesser/Butter Combos

    Quote Originally Posted by OTorresUSMC View Post
    Supposed to be a pastel/butter/ghost. I say supposed to because i bought him at PetSmart(i know i know stupid move) as a Female. Well after some months I popped him and oh guess what was staring me in the face, yep hemipenes. So who knows what else they got wrong lol


    Sent from my SM-G935V using Tapatalk
    I'm no expert but I'd say that could be a pastel butter ghost. It's definitely more then a butter. To me it looks like a butter ghost + something else and that something else could easily be pastel.


    Sent from my iPhone using Tapatalk

  13. The Following User Says Thank You to kxr For This Useful Post:

    OTorresUSMC (03-30-2017)

  14. #28
    Registered User
    Join Date
    02-22-2017
    Location
    Budapest, Hungary
    Posts
    57
    Thanks
    50
    Thanked 32 Times in 20 Posts
    As for butter, my project for the upcoming season will be butter x butter and as a backup spider x butter. I have got also an enchi x lesser x pastel that will be bred to a normal and after will combine them with butter. Also pinstripe will be added in near future. Im dedicated to butter cause that was my first bp morph.

  15. The Following User Says Thank You to Cybred For This Useful Post:

    rlditmars (03-30-2017)

  16. #29
    BPnet Lifer rlditmars's Avatar
    Join Date
    05-05-2012
    Posts
    2,964
    Thanks
    1,751
    Thanked 2,884 Times in 1,505 Posts

    Re: Enchi Lesser/Butter Combos

    Took a group shot today outside of my combos. A couple of the girls are bashful. Thanks for looking.

    [IMG][/IMG]

    [IMG][/IMG]
    Last edited by rlditmars; 04-12-2017 at 01:11 PM.

  17. The Following User Says Thank You to rlditmars For This Useful Post:

    dr del (04-13-2017)

Page 3 of 3 FirstFirst 123

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1