» Site Navigation
1 members and 1,727 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,050
Threads: 249,210
Posts: 2,572,716
Top Poster: JLC (31,651)
|
-
Re: Enchi Lesser/Butter Combos

A very uncomfortable lesser xx
Sent from my iPhone using Tapatalk
-
The Following User Says Thank You to embrit345 For This Useful Post:
-
Re: Enchi Lesser/Butter Combos

And Jeffrey the dufus butter pastel poss het ghost tree Python lol xx
Sent from my iPhone using Tapatalk
-
The Following User Says Thank You to embrit345 For This Useful Post:
-
-
The Following User Says Thank You to Alexiel03 For This Useful Post:
-
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 3 Users Say Thank You to asplundii For This Useful Post:
Jollyrogers (03-23-2017),rlditmars (03-22-2017),Slowcountry Balls (03-29-2017)
-
Re: Enchi Lesser/Butter Combos
 Originally Posted by embrit345
And Jeffrey the dufus butter pastel poss het ghost tree Python lol xx
Sent from my iPhone using Tapatalk
Lovely to see them climbing !!
He's a beauty !
Sent from my iPad using Tapatalk
-
-
Re: Enchi Lesser/Butter Combos
 Originally Posted by Zincubus
Lovely to see them climbing !!
He's a beauty !
Sent from my iPad using Tapatalk
Thanks hun. He was the handsome little chap that you had your eye on when I first picked him up lol He has been here almost a year now and is a total gem. Pain the bum feeder mind but a good boy none the less xx
-
-
Re: Enchi Lesser/Butter Combos
 Originally Posted by asplundii
Those two in the second pic have lesser/butter? Awesome animals!
Sent from my iPhone using Tapatalk
-
-
-
The Following 2 Users Say Thank You to Stewart_Reptiles For This Useful Post:
kxr (03-22-2017),rlditmars (04-12-2017)
-
Re: Enchi Lesser/Butter Combos
 Originally Posted by Deborah
As for my contribution I won't post all the enchi or lesser combos I have hatched over the years but I will post 2, the difference between those two is only one gene
3 Genes animal
4 Genes animal

Leopard adds so much to lesser/butter. Thanks for sharing
Sent from my iPhone using Tapatalk
-
The Following User Says Thank You to kxr For This Useful Post:
-
Re: Enchi Lesser/Butter Combos
Supposed to be a pastel/butter/ghost. I say supposed to because i bought him at PetSmart(i know i know stupid move) as a Female. Well after some months I popped him and oh guess what was staring me in the face, yep hemipenes. So who knows what else they got wrong lol

Sent from my SM-G935V using Tapatalk
0.1 Woma Pinstripe "Gemma"
0.1 Ultramel "Lyla"
0.1 Bamboo Woma "Tara"
0.1 Rio(Super Arroyo) "Wendy"
1.0 Clown "Happy"
1.0 Pastel Butter Ghost "Unser"
1.0 KillerBee Yellow Belly "Half-Sack"
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|