» Site Navigation
0 members and 1,746 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,049
Threads: 249,210
Posts: 2,572,716
Top Poster: JLC (31,651)
Welcome to our newest member, Mikvik
|
-
Registered User
Ibd concern as a human
Is there any reason at all to think that Ibd could infect humans?
Stupid, but perhaps relevant question.
1.0 Labrador Retriver
1.0 Ball python Mojave
0.1 Ball python Enchi Pastel
-
-
No... it's a python and boa specific disease. It can't even infect corn snakes.
-
The Following User Says Thank You to redshepherd For This Useful Post:
-
Re: Ibd concern as a human
 Originally Posted by Aldhissla
Is there any reason at all to think that Ibd could infect humans?
Stupid, but perhaps relevant question.
IBD is the result of an internal attack on a Boa constrictor or python by a particular virus known simply as arenavirus, which belongs to the family arenaviridae.
Although some types of arenavirus are known to inflict humans with various disorders, the virus which causes IBD in particular and belongs to the arenavirus genera (of which there are two) reptarenavirus, does not. Members of the other arenavirus genera mammarenavirus, do affect humans and other types of mammals depending on the affliction.
Reptile Mag.
Name: Christian
0.1 Albino Ball (Sophie)
0.1 Russo White Diamond (Grace)
1.0 Hypo Burmese (Giacomo/AKA Jock)
1.2 Razors Edge/Gotti & American Pit Bull
----------
1.1 Albino/Normal Burmese (Mr & Mrs Snake)
1.0 Albino Ball (Sully)

-
The Following User Says Thank You to CALM Pythons For This Useful Post:
-
None whatsoever. It appears that the receptors the virus uses to bind to snake cells are not found in mammalian cells
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
AbsoluteApril (02-09-2017),Reinz (02-09-2017)
-
Re: Ibd concern as a human
 Originally Posted by redshepherd
No... it's a python and boa specific disease. It can't even infect corn snakes.
It was thought IBD was found in a king snake and a palm viper. I'm having tough time finding the sources. Here's the one about the pit vipers: https://www.ncbi.nlm.nih.gov/pubmed/11243371
just FYI!
-
-
Re: Ibd concern as a human
 Originally Posted by AbsoluteApril
Oh, I didn't know that! Hmm I'd say that since it says "resembling inclusion body disease", it indicates they didn't actually do tests to check if it's the same virus, and it could be just a disease with similar symptoms.
Last edited by redshepherd; 02-09-2017 at 05:40 PM.
-
The Following User Says Thank You to redshepherd For This Useful Post:
-
Registered User
Thanks guys. I know its a arenavirus, and i know that also ebola and other contagious to human diseases are arenaviruses.
Btw, whats the latest regarding Ibd. I have heard it spreads thru mites and contact, probanly airborne to, but were does it begin? Is it the rodents we feed?
1.0 Labrador Retriver
1.0 Ball python Mojave
0.1 Ball python Enchi Pastel
-
-
There is no clinical evidence IBD can be transmitted to humans. Any diseases known to infect certain species or kingdom has a very difficult time adapting to and infecting genetically dissimilar species. Considering how different people are from snakes and reptiles genetically, it is very unlikely the disease can "jump" to humans. Now the possibility exists, but if it were the case, considering how widespread reptile ownership is, you would have seen some evidence of human infection by now.
Arenaviruses are known to infect and use rodents as hosts, so it is possible IBD developed from snakes cusuming rodents somewhere in ages past, but this is mostly speculation. The spread and source of IBD is not currently well researched, but there has been some anecdotal evidence that mites can spread the disease. There have been reports of collections that became mite infested and IBD spread throughout said collection.
Prevalence of IBD has been estimated in some peer-reviewed journals, most notably by E. Jacobson. Prevalence disproportionately favors boa constrictors (BCIs), but has been found in vipers, ball pythons, rainbow boas, dumerials boas, haitian boas, and reticulated pythons. There was also a report of an eastern kingsnake with IBD-like symptoms, but actual disease was never confirmed as far as I know. In boa constrictors, a US study and german study found the prevalence in to be anywhere from 9.4% to as high as 42%. This data was from approximately 30 collections each and roughly 85% of snakes appeared clinically healthy. While ball pythons and other non-boas have been known to get the disease, within the aforementioned studies, no ball pythons were observed to have IBD using both HE staining techniques and PCR testing. Within the tests, one out of four reticulated pythons was diagnosed with IBD as well as 2/16 burmese pythons and 4/35 rainbow boas.
It is worth noting however that 17.8% of ball pythons were diagnosed with paramyxovirus. In short, I would wager a few things: (1) IBD is not widespread throughout captive ball python collections, but it is likely sub-clinical in many boa constrictor collections and people who observe IBD in ball pythons probably also keep boa constrictors. (2) If a ball python was infected with IBD, I do not beleive the "common knowldge" that pthons succumb to the disease "quickly" or within weeks is likely accurate in many cases or should be taken as a rule. That said, paramyxovirus should be far more concerning for ball python owners.
So what can you do about it? You can have your ball python tested by specialized institutes such as florida university or Northwest zoopath. While PCR testing is the current standard for boa constrictors, I am unconvinced this is valuable for snakes outside this species as I have yet to see a ball python or even rainbow boa that was able to be diagnosed in this fashion in reported works. However, it is possible I do not have all the data in that regard. HE staining from either an organ biopsy or observed peripherial white blood cells from a blood sample have shown to be able to diagnose disease in multiple species, but no option is foolproof.
-
The Following User Says Thank You to Regius_049 For This Useful Post:
AbsoluteApril (02-09-2017)
-
Re: Ibd concern as a human
 Originally Posted by Aldhissla
Thanks guys. I know its a arenavirus, and i know that also ebola and other contagious to human diseases are arenaviruses.
Btw, whats the latest regarding Ibd. I have heard it spreads thru mites and contact, probanly airborne to, but were does it begin? Is it the rodents we feed?
No Rodents don't even get it to be able to pass on.... There are all kinds of articles about it online so most of us only know what we have read. It's a big mystery still as far as I'm concerned except for the effects. I suppose if feeders were subjected to a snake with IBD then put into another enclosure it could get that snake sick... It terrible contagious whether its transference or direct.
Last edited by CALM Pythons; 02-09-2017 at 09:31 PM.
Name: Christian
0.1 Albino Ball (Sophie)
0.1 Russo White Diamond (Grace)
1.0 Hypo Burmese (Giacomo/AKA Jock)
1.2 Razors Edge/Gotti & American Pit Bull
----------
1.1 Albino/Normal Burmese (Mr & Mrs Snake)
1.0 Albino Ball (Sully)

-
-
Re: Ibd concern as a human
 Originally Posted by Aldhissla
Thanks guys. I know its a arenavirus, and i know that also ebola and other contagious to human diseases are arenaviruses.
Ebolavirus is not an Arenavirus. Ebolavirus is a Filovirus. Totally different genus.
 Originally Posted by Regius_049
Arenaviruses are known to infect and use rodents as hosts, so it is possible IBD developed from snakes cusuming rodents somewhere in ages past, but this is mostly speculation.
Given the architecture of the virus, I am inclined to think it is more likely that it came in to being as a result of a co-infection event followed by a host-switch event
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|