Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 708

0 members and 708 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,908
Threads: 249,107
Posts: 2,572,126
Top Poster: JLC (31,651)
Welcome to our newest member, KoreyBuchanan
Results 1 to 3 of 3
  1. #1
    Registered User Ballpythonguy92's Avatar
    Join Date
    11-20-2016
    Posts
    393
    Thanks
    214
    Thanked 115 Times in 91 Posts

    Is this a banana albino is think it is what was out you?

    So I had bred my vpi axanthic female to my male banana and when the eggs finally hatched I had a big surprise 3 albinos along with 5 albinos and 2 normal hets and after talking with the breeder I had got them from I found out they were indeed poss het for albino but out of the 3 albinos I got 1 was very pale it looks like it's in shed all the time he is a male and has a similar pattern to the banana siblings but I thought I'd post the poss banana albino next to its female albino sibling and get your thoughts but I am planning on raising and breeding him to find out for sure
    https://m.facebook.com/story.php?sto...64030447112018

  2. #2
    Registered User Ballpythonguy92's Avatar
    Join Date
    11-20-2016
    Posts
    393
    Thanks
    214
    Thanked 115 Times in 91 Posts

    Re: Is this a banana albino is think it is what was out you?

    Hi sorry for the fb link I didn't know how to post pictures and my friend said to download this app so here's the maybe albino banana I'd love all your opinions on him and do you think if he is would he get spots? Black or like I'm thinking yellow?









    Sent from my SM-G920W8 using Tapatalk

  3. #3
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Yes, this is likely an Albino Banana, it resembles the others I have seen documented
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1