» Site Navigation
1 members and 618 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,912
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
I also find it interesting how most Paradox animals have the exact same pattern on both parts, it's like pattern gets determined after the theoretical combination but color determined before hand
-
-
Re: Is paradox genetic?
As it relates to the paradoxing, if the animals are the same morph would you be able to tell the paradoxing if they were fraternal twins ( different eggs) as opposed identical twins (same egg)?
 Stay in peace and not pieces.
-
-
I've never heard of identical twin snakes
-
-
Re: Is paradox genetic?
 Originally Posted by OhhWatALoser
I've never heard of identical twin snakes
in this context, i think Albert means twins as being born in the same egg as opposed to being born in the same clutch.
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
-
As far as I know, you can't tell something is Paradox without it being a different morph.
-
-
Re: Is paradox genetic?
 Originally Posted by OhhWatALoser
As far as I know, you can't tell something is Paradox without it being a different morph.
that's probably right. i've heard paradoxing described as a window through the morph skin into another skin usually a normal BP's colors and pattern. and i've heard chimeras described as a WTF, how did that gene get in there?! for example, the Highway chimera with 2 big rings/bands of Albino along the body.
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
-
So I am curious how possible it would be to have testes one from one twin and one from the other? You could possibly be throwing a morph where there was no outward indication that the gene was even there.
-
-
Re: Is paradox genetic?
 Originally Posted by distaff
Nick Mutton (Herpnation Radio Network) has an interview with a geneticist on chimeras and other rare oddities.
Wish I could remember the scientist's name - sorry.
That would have been me.
 Originally Posted by distaff
Very interesting, great discussion. One of his best programs.
Glad you liked the show
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|