» Site Navigation
0 members and 1,895 guests
No Members online
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.
» Today's Birthdays
» Stats
Members: 76,096
Threads: 249,238
Posts: 2,572,918
Top Poster: JLC (31,651)
Welcome to our newest member, JoRyMe
|
-
07-09-2013, 02:16 AM
#221
I'm pretty sure the entire BP world is watching this. Good luck!
-
The Following 3 Users Say Thank You to Coopers Constrictors For This Useful Post:
Buttons (07-09-2013),Tom Pecanic (07-12-2013),Wes (07-09-2013)
-
07-09-2013, 03:00 AM
#222
BPnet Veteran
Re: Big News Coming Tomorrow!
 Originally Posted by Family Reptiles
Another picture of the female on eggs. Sorry I didn't add a message to the picture I just posted. She was bred to a pinstripe male. She is back on food and doing very well. Eggs are due to pip around 8/2/13. Certainly no guarantee that everything is going to go perfectly, but so far it is looking good.
I wish you the best of luck, hopefully you will hit some nice Desert pins
- - - Updated - - -
 Originally Posted by Witchbane
All the best Joe..good luck
-
-
07-09-2013, 03:41 AM
#223
Big News Coming Tomorrow!
 Originally Posted by Robyn@SYR
I thought Family Reptiles sounded familiar. They had the table next to us at the Daytona show.
Chad told me today that he spent a couple of hours at the show chatting them up all about the Desert project and his breeding strategies. Temps, feeding, cycling, weights, pairing, etc.
I don't know if that paid a key role in their success, but I am glad to see it!
If there was a strategy that may have played a role in this being successful I think it should be shared. Hence my earlier question about anything being different with the care. Family Reptiles was there anything different than normal? And the questions about who produced your desert was not answered nor were the questions about these supposed other breeders. I did not look at the time stamps of the posts so it may just be you have not had time to respond. Im mostly curious where all these deserts came from because it would make most sense to me if they were all from the same line. That would also be good to know becaus that could prevent unnecessary harm to animals that are maybe not viable.
0.1 Albino
0.2 Classic
0.1 Het. Red Axanthic
0.1 Mojave h. Ghost
0.1 Pastel
0.1 Spider h. Ghost
1.0 Black Pastel
1.0 Blue Eye Leucistic h. Ghost
1.0 Lesser
1.0 Pastel h. Ghost
0.1 Morelia bredli
0.0.1 Varanus acanthurus (Silly)
0.1 Brachypelma auratum
0.1 Scottisch Fold (Tipsy)
0.1 Abyssinian (Prim)
http://www.facebook.com/AAExoten
-
-
07-09-2013, 08:10 AM
#224
Registered User
Re: Big News Coming Tomorrow!
To everyone,
Please be patient. Given the challenges with Deserts we want to ensure that the information we are giving is as accurate and beneficial as possible. The details wil be given in due time, but we feel it necessary to collaborate with the other breeders that have viable eggs from a desert female. The original purpose of my initial post was twofold. One was to make contact with the OP for collaboration and to let him know that someone else also has had a female lay. The other reason was to let everyone else know that there was more than one female that has laid good eggs as well.
The details of who the other breeders are not being shared yet mainly because we do not have their go ahead on giving that info out. Their eggs are a couple of weeks behind ours and I imagine they want to wait and see what happens first. As I mentioned, even with our eggs only having a couple of weeks before they are due, there are no guarantees. As witnessed in this thread there are a wide range of beliefs as to when the announcement of viable Desert eggs should be made. We are somewhere in the middle on this belief.
Efforts are being made to determine if the females have come from a common line, or if temperatures were a factor, or age, or weight, or whatever thing or combination of things may have contributed to the success.
-
The Following 17 Users Say Thank You to Family Reptiles For This Useful Post:
- + Show/Hide list of the thanked
-
Action Reptiles (07-10-2013),Annarose15 (07-09-2013),Badgemash (07-09-2013),Bruceweb (07-09-2013),Cross Exotics (07-09-2013),h00blah (07-09-2013),heylookitsjon (07-12-2013),jben (07-09-2013),joebad976 (07-09-2013),jsmorphs2 (07-09-2013),liv (07-11-2013),robpirk (07-11-2013),Robyn@SYR (07-09-2013),sissysnakes (07-09-2013),WFA (07-10-2013),Whispre (07-09-2013),wwmjkd (08-01-2013)
-
07-09-2013, 11:36 AM
#225
BPnet Veteran
If this all works out I would love to see the genetics of the desert proven out and see if a super is even possible
-
The Following User Says Thank You to Dragoon For This Useful Post:
-
07-09-2013, 11:45 AM
#226
I read some people stating that the OP should not have shown or announced this until after the eggs hatched, but up until this point, have we ever had pictures of a desert on good eggs? I don't recall ever seeing that. Always slugs.
Wishing the best of luck for healthy clutches to the OP and Family Reptiles. Anxious to see what comes out of the eggs.
-
-
07-09-2013, 12:17 PM
#227
Good luck to all the people that have Desert clutches waiting. I would definately love to hear more. More important are these all from the same line and/or breeder. If so looking forward to see if these females currently laying maybe had been incubated at a differant temperature/humidity then the "norm" when they had been in eggs themselves. It's been said by many that the original pastel desert looks differant then usual which could have had something to do with the way they had been incubated when they where in the egg.
1.0 Bumblebee (Sheldon)
1.0 Enchi (Jaxon)
1.0 Phantom (Leonard)
1.1 Pastel Het Genetic Stripe(Clyde+Bonnie)
0.1 LemonBlast (Dottie)
0.1 Cinnamon (Cindy)
0.1 Pied (Pissy)
0.1 Phantom (Priya)
0.1 Butter (Bernadette)
0.1 Lesser (Penny)
0.1 Pastel (Ivy)
0.1 Normal (Amy)
1.0 Boxer (Rocky)
1.0 Sugarglider (Oreo)
-
-
07-09-2013, 01:38 PM
#228
I would like to make a few comments here if I may...
Identity of the snake notwithstanding I think people need to consider a few things before making the claim that this is an absolute game changer for the morph. But first, a small point of clarification -- I do not know why everyone is under the impression that these eggs will not hatch. The issues with Desert females looks to be associated with the development/progress of the eggs inside the female. Once the eggs are out there should be no issues with them.
Now, on to this specific incident.
There is an established trend line of female Deserts having issues. And here we now have a couple incidents of a female Desert laying a viable clutch. How is this unequivocal proof that the Desert female issue has been forever solved?
Let me phrase it back to you this way. What is the rate at which Caramels kink? What is the rate that SuperCinnys duckbill or kink? What is the rate that SuperLessers bug-eye? Just shooting from the hip I would guess these numbers to be about 40%, 15% and 5% respectively. Flip side being that 60%, 85% and 95% of these morphs are perfectly fine. So, because 60% of Caramels do not kink does that me we all go around saying that the problem of Caramel kinking has been solved? Of course not, it would be utterly ridiculous and foolish. So why are people using these couple Desert females as "proof" that Desert females have been "cured"? It is a haphazardous and dangerous stance to take.
Are there Desert females out there that could potentially have a viable clutch? Certainly. Do these few viable female Desert mean that all Desert females are now viable? Not hardly. Given the obvious trend line, is it prudent to breed female Deserts? That is for you to decide on your own. My personal feeling is that it is too great a risk and as such I will never add the Desert gene to my collection (by the same token I think the risk of kinking in Caramels is too great and so to I will not add that gene to my collection.) But that is just my opinion, you can do with your snakes whatever you wish.
Lastly, I have seen a number of people allude to the "cure" for the Desert issue being stacking more mutations on to Desert. This simply will not work. Does adding BlackPastel to Albino "cure" the animal from being an Albino? Does adding Mojave to Hypo "cure" the animal from being Hypo?
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 19 Users Say Thank You to asplundii For This Useful Post:
- + Show/Hide list of the thanked
-
Aes_Sidhe (07-09-2013),Alicia (07-09-2013),Annarose15 (07-09-2013),Badgemash (07-09-2013),behindblueyes (07-09-2013),Coleslaw007 (07-10-2013),Damzlfly (07-10-2013),h00blah (07-10-2013),hogboy (07-10-2013),Jam Reptiles (07-09-2013),jben (07-09-2013),MajesticBalls (07-11-2013),Mike41793 (07-09-2013),MootWorm (07-09-2013),Murse (07-09-2013),nykea (07-10-2013),satomi325 (07-09-2013),Stewart_Reptiles (07-09-2013),TheSnakeGeek (07-09-2013)
-
07-09-2013, 01:50 PM
#229
Re: Big News Coming Tomorrow!
 Originally Posted by asplundii
Lastly, I have seen a number of people allude to the "cure" for the Desert issue being stacking more mutations on to Desert. This simply will not work. Does adding BlackPastel to Albino "cure" the animal from being an Albino? Does adding Mojave to Hypo "cure" the animal from being Hypo?
You were making some intelligent head way until you equated the problems laying and forming eggs to a morph.
Oh, yeah, I just picked up a super hypo, enchi, black pastel, cantlayeggs female.
Now, had you said "does stacking more genes on spiders remove the wobble?" I would agree entirely with you. However, you didn't.
Sent from my SAMSUNG-SGH-I747 using Tapatalk 4 Beta
-
-
07-09-2013, 01:55 PM
#230
Big News Coming Tomorrow!
I agree with what travis said. I have faith that those eggs will hatch because problems with desert females don't really have anything to do with the eggs. I was under the impression that it was problems with the females themselves, as he said. My point was that I don't think the dam carries the desert gene, so I don't think we'll see any desert babies when they hatch. I also am having trouble seeing desert in the snake that Family Reptiles posted. I'll ask again, where was the desert that Family Reptiles has, purchased from?
Last edited by Mike41793; 07-09-2013 at 01:55 PM.
1.0 normal bp
-
The Following User Says Thank You to Mike41793 For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|