» Site Navigation
1 members and 2,148 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,060
Threads: 249,212
Posts: 2,572,733
Top Poster: JLC (31,651)
|
-
A random collaboration of questions
In my quest to "learn through exposure", I've hit a few questions. Thank you for reading / answering / just clicking the thread 
1.) Every time I see a picture of a spied or some sort of visible piebald with a spider trait, the whole snake is white with a colored head. Just a coincidence, or is that a common thing?
2.) Granite.... what is it? It looks like a normal to my untrained eye.
3.) Same goes for Yellowbelly.
4.) In your mind, how much of a price increase is "fair" from a normal morph price to that morph + 100% het for a recessive gene? I've seen normals hit a huge price spike for being a het.
5.) Away from the topics of morphs- there's no reason keeping a male and female in close proximity (i.e. same room- and across the room, not same tank) should cause a change in behavior, correct? Breeders keep males and females on top of each other in racks don't they? My female has been acting strange but I can't imagine it's because of the young male I got a couple of weeks back. By strange, I mean: far more active than usual, not as much in her hide, suddenly prone to escaping or trying to escape (where as, she never has attempted it in the past 4 years of ownership), seems a bit more skittish when I take her out, etc.
Again.. thank you!
-
-
Here's a few..
1) That is unique to spieds. 
2) Has "granited" specks and wonky pattern.. you may learn over time.
3) clear belly, blushing, often high red/orange in colouration, blushing, flames ect. At least the good ones do.
4) not really sure, but it definitely matters on the morph. For example, my female normal het pied I got as a ~350 gram babyish size, a normal would probably be in the 40-70$ range, but being female adds some, and being well-started adds some, and the hypo adds some. Because hypo isn't a very expensive gene, it doesn't add a whole lot of price to a het. A het pied is a different story because pied is a very expensive, high-regarded gene.
5) Yes, they do. I don't know much about it, but she may also get used to it after a few months.
Chloe
0.1 Het Hypo- Indy
The cup is useful because of it's emptiness
-
-
BPnet Veteran
Re: A random collaboration of questions
1.) Every time I see a picture of a spied or some sort of visible piebald with a spider trait, the whole snake is white with a colored head. Just a coincidence, or is that a common thing?
Most Co Dom mutations when bred into pied result in a more white snake with head pattern the select few that eat up all the white and show a lot of pattern down the rest of the snake are Enchi, Pin, and a few others i cant remember.
2.) Granite.... what is it? It looks like a normal to my untrained eye.
3.) Same goes for Yellowbelly.
I have no clue what to look for in granites to me they are normals and not worth buying as a single gene. YB's can be either stunners or very bland but the big key for me is the belly pattern is really dirty and the sides of the belly have a sort of pixelated pattern.
-
-
Re: A random collaboration of questions
 Originally Posted by DestinyLynette
In my quest to "learn through exposure", I've hit a few questions. Thank you for reading / answering / just clicking the thread
1.) Every time I see a picture of a spied or some sort of visible piebald with a spider trait, the whole snake is white with a colored head. Just a coincidence, or is that a common thing?
This is the trait of spieds and many other pied combos.
2.) Granite.... what is it? It looks like a normal to my untrained eye.
Some are genetic, some are not. Black speckling/dotting inside the side pattern
3.) Same goes for Yellowbelly.
super awesome morph, learn it, love it, get it! Lots of flaming from the belly (orangeish in color), slight head stamp, speckled belly on the side of the belly, clear down the center. The more blushing and flames the better!
4.) In your mind, how much of a price increase is "fair" from a normal morph price to that morph + 100% het for a recessive gene? I've seen normals hit a huge price spike for being a het.
This depends ENTIRELY on what recessive. Het ghost/hypo only adds a small increase, whereas say het desert ghost would jump the price by a grand or more.
5.) Away from the topics of morphs- there's no reason keeping a male and female in close proximity (i.e. same room- and across the room, not same tank) should cause a change in behavior, correct? Breeders keep males and females on top of each other in racks don't they? My female has been acting strange but I can't imagine it's because of the young male I got a couple of weeks back. By strange, I mean: far more active than usual, not as much in her hide, suddenly prone to escaping or trying to escape (where as, she never has attempted it in the past 4 years of ownership), seems a bit more skittish when I take her out, etc.
It is possible. How old/big is the male? Have you changed anything else about her set up? Is she just now getting to adult size?
Again.. thank you!
Answers in bold!
-
-
A random collaboration of questions
Others have already answered your questions but this may help you with the YB question. This is my YB next to my normal:

A good quality YB will look nothing like a normal. Some of the crappier examples are more normal looking.
-
-
I think the better answer, that no one has given, for YB is that it is a visual het form (albeit somewhat subtle) of the Ivory which is the "strongest" phenotype in the Stripe-Backed allele group (this group also contain the morphs Flare, Spark, Specter and Gravel.)
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
bcr229 (07-09-2013),rossi46 (06-14-2013)
-
A random collaboration of questions
As far as the price added for being a het, that depends entirely on the morphs involved. For example, Hypos have come down in price quite a bit, so a morph that is het Hypo may not be that much more than one that is not. On the other hand, Desert Ghost is still a very high end morph, so anything that is het Desert Ghost will be pricey, and that price is justified. Animals that are het for more than one gene are also worth more. For example, het Albinos and het Pieds are both pretty affordable, but a snake that is het for both genes is worth quite a bit more because it has the potential to produce a Pied Albino.
-
-
Thank you everyone for your answers The male is only 3-3 1/2 mo old and 150g or so; a baby. She's an adult- we don't know her exact age because she was a rescue, but we have record of her for about 12-13 years. I'd love to know how old she is; I hope she's not too old to breed in a month or two. Nothing else has been changed about her enclosure.
The picture helped a lot with the YB. I think I've been seeing low quality ones maybe.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|