» Site Navigation
2 members and 610 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,912
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
Registered User
Pastel soulsucker ball python
What are the genes in a pastel soul sucker ball python? I really want to produce one. I cant find the morphs that are in it. Please help!
-
-
Pastel, lesser, granite, hidden gene woma.
1.0 firefly ball python
1.0 100% Pastel het clown ball python
1.0 Enchi ball python
1.0 Super Pastel 100% het pied (Richard)
0.1 Butter 100% het ghost
0.1 Pastel 100% het pied (Keira)
0.1 Butter 50% het Ghost Ball Python (Penny)
0.1 100% het Ghost
0.1 Normal Ball Python (Irwin)
0.1 Mojave Ball Python (Eve)
0.1 Black Bee Ball Python (Charolette)
0.1 Pintripe (Olivia)
0.1 Dumeril's Boa (Peaches)
1.0 Bearded Dragon (Dude)
-
The Following User Says Thank You to Trackstrong83 For This Useful Post:
-
Registered User
Re: Pastel soulsucker ball python
Pastel, Lesser, Hidden gene woma.
The "granite" is a marketing ploy used by NERD
-
-
Pastel soulsucker ball python
 Originally Posted by Spartan452
Pastel, Lesser, Hidden gene woma.
The "granite" is a marketing ploy used by NERD
I've recently been proven wrong on the granite part of the HGW stuff. I used to think it was a ploy but now I'm not so sure. There is definitely another gene at play causing some busy pattern to come through.
-
-
Re: Pastel soulsucker ball python
 Originally Posted by interloc
I've recently been proven wrong on the granite part of the HGW stuff. I used to think it was a ploy but now I'm not so sure. There is definitely another gene at play causing some busy pattern to come through.
I don't believe it's a 'ploy' but more of a gene combination that kevin hasn't fully figured out yet. I'm convinced that the NERD granite gene is heriditary and that he knows the markers, but I'm not entirely convinced that he knows (or has made public) exactly how it's inherited. there is some debate as to whether it's inextricable once bred to certain other genes.
to the OP, a pastel soul sucker can be produced by combining the NERD 'hidden gene' woma (not PHR) with a pastel lesser.
-
-
I think it is more correct to say that Kevin's public statements that the "neck spot" is the marker for Granite on HGW is not exactly accurate. Are there Granite HGW that have a neck spot? Certainly. But are all HGW that display a neck spot absolutely carrying the Granite gene as well? Certainly not.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|