» Site Navigation
0 members and 593 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,912
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
-
-
Re: I think my "silver bullet" is just a super cinnamon.
Looks like a super cinni to me
Sent from my SPH-D710 using Tapatalk 2
1.0 Spider "Charlie"
1.1 Normal "Precious" "Chumley"
0.1 Pastel "Sweet Dee"
1.1 Mojave "Stewie" "Little Bit"
0.1 Lesser "Sally"
1.0 Pied "Jack"
1.0 Nile Monitor "Superman"
0.1 Bearded Dragons "Snookie"
0.0.1 Sulcuta Tortoise "Kenny Powers"
1.0 Chocolate lab "Dante"
1.0 Now snake obsessed boyfriend
-
-
Re: I think my "silver bullet" is just a super cinnamon.
Who did you buy her from?
Sent from my SAMSUNG-SGH-I747 using Tapatalk 2
Balls:
0.1 '?? Normal
0.1 '10 Pastel
0.1 '10 Yellowbelly het Genetic Stripe
1.0 '11 Lesser
1.0 '09 Lesser
1.0 '11 Fire
1.0 '07 Spider
1.0 '11 Black Pastel
1.0 '81 Husband
2.0 '03/'10 Offspring
Gravid with 1.0.1 twins due Oct 9th 2012
-
-
BPnet Veteran
My ultimate goal is an Albino Clown Pied.
-
-
To my untrained eye it looks like a super cinny. Found this picture of a silver bullet x pastel lesser (not mine) @ http://heathersherpsblog.blogspot.co...1_archive.html
Females: 0.1 fire; 0.1 sugar; 0.1 GHI; 0.1 pinstripe het desert ghost; 0.1 mojave spider; 0.2 mojave; 0.1 black pewter blast; 0.1 leopard pied; 0.1 champagne; 0.1 pied; 0.1 super pastel lesser; 0.1 pewter; 0.1 spider het pied, 0.1 bumblebee; 0.1 lesser; 0.1 spider; 0.1 normal; 0.3 het pied
Males: 1.0 het desert ghost; 1.0 pastel pied; 1.0 leopard; 1.0 black pastel; 1.0 enchi; 1.0 mojave; 1.0 cinnamon; 1.0 pied; 1.0 vanilla
Other species: 1.0.3 pacman frogs (sunkissed, super apricot, super blue, super lime green); 0.2 crested gecko; 1.0 hypo hog island boa; 0.1 normal boa; 1.0 rottweiler; 1.0 chihuahua
instagram = lesliep91
-
-
Re: I think my "silver bullet" is just a super cinnamon.
She has the super cinny nose, thats for sure. Duckbill expressed. Super cinny and super black pastel and also cinny + black pastel combos eradicate the pattern, we all know that, right?
So i have to say this is a super cinnamon, and it is unclear if there is pastel in it. This BP looks quite light colored for a super cinny. Most helpful would be clutch images (the siblings), and pictures of the parent snakes. Super black pastel and cinnamon/black pastel combos would be darker i think, but we got the nose, so i say super cinnamon and maybe something else. Give data on the parents, this will help a lot. I say super cinny pastel, but want to see the parents.
EDIT: might also be super cinny lesser or super cinny fire, really hard to tell.
Last edited by Pythonfriend; 05-21-2013 at 08:03 PM.
-
-
Re: I think my "silver bullet" is just a super cinnamon.
yeah, Ive been "burned" more than once by Ian of Outback reptiles. Wont ever be buying from him again.
ALL THAT SLITHERS - Ball Python aficionado/keeper
breeder of African soft fur Rats. Keeper of other small exotic mammals.
10 sugar gliders
2 tenrecs
5 jumping spiders
paludarium with fish
Brisingr the albino
Snowy the BEL
Piglet the albino conda hognose
FINALLY got my BEL,no longer breeding snakes. married to mechnut450..
-
-
Checking out the BOI for Outback....appearing to be many bad reviews on first glance
Females: 0.1 fire; 0.1 sugar; 0.1 GHI; 0.1 pinstripe het desert ghost; 0.1 mojave spider; 0.2 mojave; 0.1 black pewter blast; 0.1 leopard pied; 0.1 champagne; 0.1 pied; 0.1 super pastel lesser; 0.1 pewter; 0.1 spider het pied, 0.1 bumblebee; 0.1 lesser; 0.1 spider; 0.1 normal; 0.3 het pied
Males: 1.0 het desert ghost; 1.0 pastel pied; 1.0 leopard; 1.0 black pastel; 1.0 enchi; 1.0 mojave; 1.0 cinnamon; 1.0 pied; 1.0 vanilla
Other species: 1.0.3 pacman frogs (sunkissed, super apricot, super blue, super lime green); 0.2 crested gecko; 1.0 hypo hog island boa; 0.1 normal boa; 1.0 rottweiler; 1.0 chihuahua
instagram = lesliep91
-
-
I would not be so quick to write that off as not being a Bullet.
Check out Albey's:
http://www.albeysreptiles.com/images...l08_1col_6.jpg
More of this same animal can bee seen on his collection page:
http://www.albeysreptiles.com/ball_col.htm (Alphabetical so you have to scroll almost to the bottom)
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
I think the flecks of yellow indicate it could be a bullet. A silver bullet IS a super cinny, just with an extra gene. A lot of super cinnys do have little flecks of yellow like yours, but not as many? Also the part we can't really see is the top of the head. I think on a super cinny the top of the head is jet black. The one pic where it's partially visible it looks like it's blushed out yellow. Can we see the head?
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|