» Site Navigation
1 members and 1,196 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,917
Threads: 249,118
Posts: 2,572,202
Top Poster: JLC (31,651)
Welcome to our newest member, Necbov
|
-
Re: Scaleless snakes
i think when the heat pits are covered with skin like this, they are essentially gone. Infrared radiation can be effectively blocked by the thinnest paper you can imagine, and a layer of skin will do the job. And only the geometry of the pits allows ball pythons to detect the direction of incoming infrared radiation, for any directional sensing the pits need to be deep, essentially the derma-ball in the picture is half blind.
-
-
Registered User
I remember hearing about these when I was on a corn snake community. Personally, I don't like them. I would prefer mine to have scales. Just like the hairless cats. I prefer my cats to have fur (which I have three cats too). We dinker around with genetics so much, why do we need to breed for something so unnatural? I can understand why people think they are neat, but to me, it is kinda like looking at a freak show, and I feel sorry for the animal. Their skin has got to be more tender and more prone to injury and infections. I agree with what someone said above. It is one thing to save the life of one that was born without scales, it is another thing to selectively breed for it. I don't know. Just my two cents. This is one subject with snakes that I'll just agree to disagree about it.
The collection is growing:
1.0 Dumerils Boa (Khardeen), 0.1 Spider Ball Python (Charlotte), 0.1 Pastel Ball Python (Serenity), 1.1 Mojave Ball Python (Atreyu, Starr), 1.0 Black Pastel Ball python (Vader), 0.1 Enchi Champagne Ball Python (Monroe), 1.0 Enchi Ball Python (Apollo), 1.0 Citrus pastel yellowbelly ball python (Mellow Yellow), 1.1 Fire ball pythons (Fuego, Pele), 0.1 Pinstripe ball python (Vera), 1.0 Pastel Calico ball python (Monty the python), 1.0 X-Gene ball python (Wesley), 0.1 Butter X-Gene ball python (Buttercup), 0.1 Bumble Bee ball python (Honeycomb), 1.1 Red Blood Pythons (Armond, Mina), 1.1 Matrix Red Blood Python (no name, Trinity), 0.1 Splotched Sinaloan Milksnake (Lilith), 1.0 Albino Honduran Milksnake (Boros), 1.0 Desert Kingsnake (Crowley- King of Hell), 0.1 Banded Albino Kingsnake (Rhapsody)
-
-
I know a lot of people won't agree with me and I'm not trying to create an argument but I really feel that we should be looking towards the preservation of these different species and purposely breeding in a flaw is counter productive. Yes, it is interesting. Yes, it is cool to learn whats going on. I just feel that that should be as far as it goes. Same for breeding with the mindset of having a cool color- what is the point when they are sterile or consistently produce unviable offspring? Anyways- not trying to pick a fight just my thoughts.
0.1 Pastel Lesser Platinum (BP)
0.1 Dumerils Boa
0.1 Indian Sand Boa (Sunset)
0.1 Kenyan Sand Boa (Anery)
0.1 Kenyan Sand Boa (Rufescen)
0.1 Kenyan Sand Boa (Paradox Albino)
1.0 Kenyan Sand Boa (Paradox Snow)
And a lot of Tarantulas 
-
-
Re: Scaleless snakes
 Originally Posted by Cendalla
I know a lot of people won't agree with me and I'm not trying to create an argument but I really feel that we should be looking towards the preservation of these different species and purposely breeding in a flaw is counter productive. Yes, it is interesting. Yes, it is cool to learn whats going on. I just feel that that should be as far as it goes. Same for breeding with the mindset of having a cool color- what is the point when they are sterile or consistently produce unviable offspring? Anyways- not trying to pick a fight just my thoughts.
You almost had complete logic there. In fact, breeding for color at all is breeding in a flaw. Do honestly think that a banana or bee would survive in the wild? It can't hide!
Sent from my SAMSUNG Galaxy SIII using Tapatalk 2
-
The Following 2 Users Say Thank You to Kodieh For This Useful Post:
Bluebonnet Herp (03-01-2013),Bogertophis (05-25-2018)
-
Re: Scaleless snakes
 Originally Posted by Kodieh
Do honestly think that a banana or bee would survive in the wild? It can't hide!
Sent from my SAMSUNG Galaxy SIII using Tapatalk 2
I'm not really aiming this at you, but just in general.
I know everyone always talks about how the bright morphs can't survive in the wild due to lack of camouflage. But ball pythons are nocturnal and hide in burrows or termite mounds during the day where visibility is the best. So they generally are not out and about unless its dark. Bright pastels and some albinos are still found in Africa and are being imported. Even some adults. The first bannana and coral glows are imports. That has so say something right?
Just my $.02.
Sent from my DROID RAZR using Tapatalk 2
Last edited by satomi325; 02-27-2013 at 03:18 PM.
-
The Following User Says Thank You to satomi325 For This Useful Post:
-
Re: Scaleless snakes
 Originally Posted by Kodieh
You almost had complete logic there. In fact, breeding for color at all is breeding in a flaw. Do honestly think that a banana or bee would survive in the wild? It can't hide!
Sent from my SAMSUNG Galaxy SIII using Tapatalk 2
Which is why I don't have a dozen as if they were pokemon. I won't lie- I have seen some retics that have made my go 'wow, ain't nature grand?' And then realize that nature has a tendency to cull that from the wild. Its man's (and/or woman's) intervention that has allowed it and nurtured it. Call it evolution or design but nature (in most cases) favors what can hide and hunt successfully. While we can help these morphs along to see its (arguable) potential I just can't see any reason to breed for something without scales or pits. I know the dollar (or whatever currency) is important at different degrees to everyone but I hate seeing people jump on a fad because they will make a quick buck. Its an emotional argument in the end because everyone can spout numbers and statistics to support their side. I'll just never put my money in that direction.
Thank goodness I'm not up here trying to talk about crossbreeding. Because that argument is a bloody dang nightmare!
0.1 Pastel Lesser Platinum (BP)
0.1 Dumerils Boa
0.1 Indian Sand Boa (Sunset)
0.1 Kenyan Sand Boa (Anery)
0.1 Kenyan Sand Boa (Rufescen)
0.1 Kenyan Sand Boa (Paradox Albino)
1.0 Kenyan Sand Boa (Paradox Snow)
And a lot of Tarantulas 
-
-
Re: Scaleless snakes
 Originally Posted by satomi325
I'm not really aiming this at you, but just in general.
I know everyone always talks about how the bright morphs can't survive in the wild due to lack of camouflage. But ball pythons are nocturnal and hide in burrows or termite mounds during the day where visibility is the best. So they generally are not out and about unless its dark. Bright pastels and some albinos are still found in Africa and are being imported. Even some adults. The first bannana and coral glows are imports. That has so say something right?
Just my $.02.
Sent from my DROID RAZR using Tapatalk 2
But are those officially WC or CH? I honestly find it hard to believe there is a real WC albino out there, at adult size (which for me is 1200g or better). CH I can believe, capture mom let her lay and then let her go, hatch out an albino and voila.
Sent from my SAMSUNG Galaxy SIII using Tapatalk 2
-
-
Re: Scaleless snakes
 Originally Posted by pythonminion
Boas and woma pythons do fine without heat pits.
Many boas have heat pits. See this ETB: http://www.google.com/imgres?imgurl=...9QEwBA&dur=574
Woma pythons (and Blackhead pythons) also have heat pits, they are just not as flagrant as those of other pythons
 Originally Posted by Kurtilein
i think when the heat pits are covered with skin like this, they are essentially gone. Infrared radiation can be effectively blocked by the thinnest paper you can imagine, and a layer of skin will do the job. And only the geometry of the pits allows ball pythons to detect the direction of incoming infrared radiation, for any directional sensing the pits need to be deep, essentially the derma-ball in the picture is half blind.
You are quite mistaken about these animals losing their ability to sense heat. I do not know why people assume that a lack of the physical "pit" means that the snake suddenly loses the ability to sense heat. The nerves for sensing heat are still present in a scale-less ball python and they still reside in the lip area. Losing the scales that define the pit has no impact on the nerves that are present in those areas. In point of fact the pits are the result of an evolutionary process to allow those nerves to be directly exposed and not be covered by scales while still offering a degree of protection to the underlying exposed skin. The snake in that picture is not "half blind" at all, in fact, if you look back at the picture you can make out the indentation of a couple of pits, on just below the nostril and one just forward of there. It can sense heat just fine.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Scaleless snakes
 Originally Posted by Kodieh
But are those officially WC or CH? I honestly find it hard to believe there is a real WC albino out there, at adult size (which for me is 1200g or better). CH I can believe, capture mom let her lay and then let her go, hatch out an albino and voila.
There have been plenty of adult sized mutations found in the wild, including pieds and albinos.
And personally, the scaleless thing is not for me.
Last edited by Robyn@SYR; 02-27-2013 at 06:03 PM.
-
The Following User Says Thank You to Robyn@SYR For This Useful Post:
-
Re: Scaleless snakes
 Originally Posted by Kodieh
You almost had complete logic there. In fact, breeding for color at all is breeding in a flaw. Do honestly think that a banana or bee would survive in the wild? It can't hide!
Sent from my SAMSUNG Galaxy SIII using Tapatalk 2
The first known white ball python was wild caught so, yeah it could survive.
The "morphs" in BP's so far are pretty much all selective expression in greater quantity than normal of existing wild gene mutations.
Also, breeding for preservation is a non-issue so long as accurate breeding records are kept. Then even hybrids are not a "problem" as those snakes would automatically be excluded from breeding programs aimed at re-introduction should some catastrophe suddenly kill off most wild BP's.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|