Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,378

0 members and 1,378 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,937
Threads: 249,129
Posts: 2,572,290
Top Poster: JLC (31,651)
Welcome to our newest member, GeorgiaD182
Page 7 of 8 FirstFirst 12345678 LastLast
Results 61 to 70 of 73
  1. #61
    BPnet Lifer Skiploder's Avatar
    Join Date
    03-03-2007
    Location
    Under a pile of wood.
    Posts
    3,580
    Thanks
    113
    Thanked 3,727 Times in 1,257 Posts
    Images: 1

    Re: I Attended the HR2811 Hearing on July 29th

    Quote Originally Posted by qiksilver View Post
    Er, I'm pretty sure I wasn't piling on anything, but alright. I think it's too late to change any minds anywhere, in or out of our community, and I think that Matt brings up solid points on the protection of ecological niches... But that being said, it's not like those making the laws truly care about that. Everyone is being so reactive to everything that there's no way we can all work together. It's just too bad individuals can't take responsibility for their own actions (snake owners and politicians alike). I find it a little ridiculous that no one gave a damn about the ecology of the everglades until they found a convenient scapegoat.
    I wasn't referring to you, Mike.

  2. #62
    BPnet Lifer Skiploder's Avatar
    Join Date
    03-03-2007
    Location
    Under a pile of wood.
    Posts
    3,580
    Thanks
    113
    Thanked 3,727 Times in 1,257 Posts
    Images: 1

    Re: I Attended the HR2811 Hearing on July 29th

    Quote Originally Posted by asplundii View Post
    Obviously you do not know much about the environments that carpet pythons inhabit. Better do your research and then pack those babies up and ship them to someone else.



    There is not one. We all know that. (Well all of us except him it seems...)



    It is ironic. What I find more ironic is that the young lad here lives in Texas where road cruising is illegal and yet he actively practices the habit and posts pics on every forum he is on about it and then defends his actions when called out on it. And here he is telling all of us what ought to be illegal in other states...



    Like I said above, he needs to learn a little bit more about the native habitats of the carpet python he keeps



    Well I posted a link to a scientifically valid peer reviewed paper. You might want to read it and get yourself properly educated on the matter before you run your mouth off.



    Yes, we have educated opinions and you have propaganda-based ignorant opinions.



    Based on what you said there, then by your own words you ought not be keeping any pets. So, box them up and ship them out.



    I agree but I would add that it is also a battle of emotions. Fear and scare tactics are big power in this fracas we find ourselves in.



    They are doing that up in the Carolinas right now.



    You are correct, it is not enough support to ban them. There is no justification for a ban, a ban is not going to fix the problem. What is needed is regulation. Something that works to keep impulse buying down and responsible, educated buying safe.
    Congratulations. You have just continued an argument that does nothing for this community. Have you checked your state government site to see what bills may be coming down the pipe that will affect your hobby? Don't rely on the USARK and PIJAC websites, in some cases they have been several months out in warning people about upcoming legislation.......

    Enjoy your point-by-point debate with Dutchherp. In the meantime, a sensationalist media, a gullible public, a reactionary political system and well-organized and funded machines like PETA and HSUS are nibbling away at your rights. Let me give you all a pointer here: they don't care about facts. You can e-pontificate until your fingers fall off and counter every point they make..........people outside this hobby (in general) don't care - it doesn't affect them and they don't like reptiles.

    As large as this hobby may seem, we are still on the fringe. Joe Sixpack and his Suburban driving ex-prom queen wife don't care to be educated on the potential migratory routes of pythons in Florida and they sure as heck don't care about whether all those man-eating burms were released on purpose or on accident. Most people support the HSUS - they save cuddly kittens and puppies with big mournful eyes - right?

    At what point does the fact that USARK and PIJAC are now passing legislation and working on amendments to these bills clue you in to the fact that these laws are something that can't be argued away?

    While USARK did an admirable job in writing law in NC, the provisions for enforcement that they helped pen should worry everyone here. How many of you have given USARK and PIJAC feedback about the work they are doing? How many people actually know what your defenders are doing? How many of you know what legislation is coming down the pipe in your state that may affect your hobby? How about neighboring states?

    Don't you think addressing those things, or better yet educating yourself on these points, helps the cause more than debating each other point by point?

    Let me clue some people in here - there are quite a few of us that have seen this coming for awhile. This hobby has arrogantly assumed that we could keep whatever we want, anyway we want and in general, act irresponsibly with no consequences. Well, the bill is now coming due. USARK and PIJAC are having to deal with steaming pile of crap that WE made. Some of the most vocal supporters of USARK and PIJAC are the same arrogant jerks who indiscriminately sold giants and hots to people who had no business owning them......it makes me sick.

    We've had years to organize to self-regulate and we did nothing. Now we have had to organize to save ourselves from the consequences of our actions.

    While I don't keep giant pythons, I do keep rear-fanged colubrids, some of which have already made the banned lists in, for example, Connecticut. It's a matter of time before legislation surfaces that will affect my ability to keep my beloved pets in my state. I will work as diligently as possible to assist USARK and PIJAC in crafting legislation that may require other keepers to house, transport and account for their animals in a more responsible way.

    More importantly, I continue to keep my eye on legislation occurring in other states and provide feedback to the defenders of my rights so that we have a future model for preventing what is now happening in Florida.

    I am not gong to waste my time trying to educate a deaf public to the fact that my thelatornis or rhabdophis pose no threat to the them. They don't care about delivery systems of venomous reptiles, they don't care about three-finger toxins - they've already made up their minds. As Quiksilver stated - it's too late to change the minds of people. We all have differing opinions on what should be done, but the reality is that the focus is now on dealing with, heading off and amending legislation.

  3. The Following 6 Users Say Thank You to Skiploder For This Useful Post:

    bsd13 (08-03-2009),Denial (07-31-2009),DutchHerp (07-31-2009),GregBennett (07-31-2009),JLC (07-31-2009),Mendel's Balls (07-31-2009)

  4. #63
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: I Attended the HR2811 Hearing on July 29th

    Quote Originally Posted by Skiploder View Post
    Congratulations. You have just continued an argument that does nothing for this community.
    I fail to see how a divisive element within the community who obviously does not have all the facts has nothing to do with the community. If people in the community can make the same arguments as HSUS how does that have nothing to do to the community??

    Also, it is all well and good you pointing your finger at me but I hope you realize that by doing that you are sitting right here with me continuing this "worthless" argument...

    Have you checked your state government site to see what bills may be coming down the pipe that will affect your hobby? Don't rely on the USARK and PIJAC websites, in some cases they have been several months out in warning people about upcoming legislation.......
    As best I can, yes. Though it is not a daily thing for me. AS it is, so much is prohibited here it is not hard to keep up with...

    Enjoy your point-by-point debate with Dutchherp.
    This is my style of replying, it is how I think straight. If you search the forum for my posts you will see that I do it for debate or discussion or whatever. It is just my style, I do not care whether or not you like it.

    In the meantime, a sensationalist media, a gullible public, a reactionary political system and well-organized and funded machines like PETA and HSUS are nibbling away at your rights.
    You will get no argument from me on that

    Let me give you all a pointer here: they don't care about facts. You can e-pontificate until your fingers fall off and counter every point they make..........people outside this hobby (in general) don't care - it doesn't affect them and they don't like reptiles.
    It is not their ignorance of facts that bothers me. It is people within this hobby, like Dutch, who are willfully ignorant that bother me. There are valid, peer reviewed scientific articles that refute a number of his points and he willfully turns a blind eye to them.

    As large as this hobby may seem, we are still on the fringe
    Something I already knew

    Joe Sixpack and his Suburban driving ex-prom queen wife don't care to be educated on the potential migratory routes of pythons in Florida and they sure as heck don't care about whether all those man-eating burms were released on purpose or on accident.
    Having done more than a few reptile presentations for schools I disagree to an extent. If you can pique the interest of Joe Sixpack and his wife then often times you can get them to listen and they really are interested in what you have to say. The problem is that for every one family you can reach that way there are 5000000000 more being reached by the media hype. The war of attrition...

    At what point does the fact that USARK and PIJAC are now passing legislation and working on amendments to these bills clue you in to the fact that these laws are something that can't be argued away?
    You presume to know me. Never once have I said these bills are going to be argued away. I have felt and still feel that we have been playing a game of catch up for too damn long.

    While USARK did an admirable job in writing law in NC, the provisions for enforcement that they helped pen should worry everyone here. How many of you have given USARK and PIJAC feedback about the work they are doing?
    Well I for one have emailed USARK with suggestions and recommendations numerous times. Both positive and negative feedback.

    Don't you think addressing those things, or better yet educating yourself on these points, helps the cause more than debating each other point by point?
    Yeah, addressing those matters is important. However I do not think someone within the community, who has an obvious lack of understanding on the matter, spreading derisiveness is doing us one bloody bit of good either. HSUS, PETA, and the like probably love seeing us at each others throat, it makes their job so much easier.

    Let me clue some people in here - there are quite a few of us that have seen this coming for awhile. This hobby has arrogantly assumed that we could keep whatever we want, anyway we want and in general, act irresponsibly with no consequences. Well, the bill is now coming due. USARK and PIJAC are having to deal with steaming pile of crap that WE made. Some of the most vocal supporters of USARK and PIJAC are the same arrogant jerks who indiscriminately sold giants and hots to people who had no business owning them......it makes me sick.
    Well I am sick to death of all these people who talk about how they saw this coming and use every opportunity to say that. Great, you saw it coming... What the heck were you doing about it back then other than seeing it coming? A Cassandra Complex does not do us any good. So you saw it coming. And yet you did nothing about it back when you saw it coming. You are just as guilty for this mess we are in as the rest of us so take that finger you are pointing at us and turn it right back on yourself.

    I am not gong to waste my time trying to educate a deaf public to the fact that my thelatornis or rhabdophis pose no threat to the them.
    That is your choice. I still find that, on an individual level the public can be educated and turned to our side. However, when I see someone within the community being willfully ignorant I will step up. Like I said above, divisiveness within is more destructive than pressure from without.

    We all have differing opinions on what should be done, but the reality is that the focus is now on dealing with, heading off and amending legislation.
    Actually, I think that amending legislation is just continuing to play the catch up game. We, as a community need to start making the legislation. We have to start regulating ourselves because that is the surest way to keep others from deciding to step in and regulate us.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  5. The Following User Says Thank You to asplundii For This Useful Post:

    Muze (07-31-2009)

  6. #64
    BPnet Lifer Skiploder's Avatar
    Join Date
    03-03-2007
    Location
    Under a pile of wood.
    Posts
    3,580
    Thanks
    113
    Thanked 3,727 Times in 1,257 Posts
    Images: 1

    Re: I Attended the HR2811 Hearing on July 29th

    So who is up-to-date on California AB112?

    It was all the rage awhile ago, but fell off of the radar. Despite the fine job that USARK does, they haven't update on it's progress in awhile.

    Let me illustrate and example of how easily it is to have your attention diverted elsewhere with potentially disastrous results.

    When AB1122 was introduced, the Reptile NAtion decried it as an attempt to put the kibosh on reptile shows. Oh, it was cleverly concealed, but it was there.

    I argued that I had read up on the bill's history and that while the wording was ambiguous, the intent of the bill was to ban the sale of animals on street corners - a very specific problem in some urban areas of northern and southern California.

    These animals are often smuggled in from Mexico and are in horrible condition.

    NO NO NO screamed some people who had never even read the bill (but had gotten the latest USARK e-mail bulletin), this is a well-crafted and orchestrated attempt to shut down the reptile business.

    Posts were put up all over the major forums, inciting people to write their legislators and to put a stop to this malevolent attempt to kill our hobby.

    I actually called the office of the sponsor (Ted Lieu) and spoke to an aide. She was astonished that people thought that Mr. Lieu was trying to shut down dog, bird, cat and reptile shows.

    Had they received alot of feedback from the vaunted Reptile Nation? No, not really. They had heard from the Democracy of Dogs, the Confederacy of Cats and the Bird Consortium, heck, they even had heard from the Associated of Swap Meets and (I'm not making this up) a contingent of concerned citizens who run the coral frag swaps. Oh - animal rescue groups also voiced their concerns - let's not forget them.

    The Reptile Nation - well, a few call here and there, but nothing of note. Do reptiles even have shows? Yes, I said, we have expos. Oh.......

    So here we are, and like most bills, this one has gone through many amendments and iterations. Mr. Lieu has refined his bill to reflect the concerns of groups that thought they would be devastated by this bill.

    The latest amendment, from the July 7th senate hearing, now contains provisions that exempt:

    a. Cat shows
    b. Dog shows
    c. Bird shows
    d. Rescue groups
    e. Swap meets were removed from prohibited sale locations


    The last paragraph of the amendment now reads:

    Amendments Since June 23 Hearing

    This bill has been amended since it was heard in this Committee on June 23rd in order to address some of the concerns raised. Specifically, it makes clear that the prohibition on display is to display for sale and makes exceptions for the sale of fish or shellfish off a boat at a pier and for sales of animals at dog, cat, or bird shows. Are these amendments sufficient to address the concerns raised?


    I'd say not. Where are reptiles in this? Where is your voice? The might Bird Lobby preserved their rights? How about us?

    While I am a supporter of USARK and PIJAC, what does it say about them and more importantly us as a group, that while people were decrying this as an attempt to stuff the sale of every pet in California, very other group of hobbyists had their voices heard but us?

    I'll tell you what it says. We're pathetic. Until some of you wake up and pull your heads out of your rear ends we can even more expect nasty, embarrassing surprises like this in the future.

    So bravo - while Matt has been thoroughly educated as to the how worthless his opinion is, us folks in California may not be able to go to a herp show in the near future.

    So go ahead and hit me with some negative rep or a nasty, witty remark for this post. All I ask is that first you take 30 minutes of your time and do something vaguely constructive - call Mr. Lieu's office (or e-mail him) and let him know that all of the concerns have not been addressed.

  7. #65
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: I Attended the HR2811 Hearing on July 29th

    Quote Originally Posted by Skiploder View Post
    So go ahead and hit me with some negative rep or a nasty, witty remark for this post. All I ask is that first you take 30 minutes of your time and do something vaguely constructive - call Mr. Lieu's office (or e-mail him) and let him know that all of the concerns have not been addressed.
    Skip, just an FYI for you, I have never once dolled out negative rep to anyone and I am not about to now. Quite honestly I do not have anything negative to say or think about this post. It makes a very good point. And I will happily draft up a note to Mr. Lieu.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  8. #66
    BPnet Lifer Skiploder's Avatar
    Join Date
    03-03-2007
    Location
    Under a pile of wood.
    Posts
    3,580
    Thanks
    113
    Thanked 3,727 Times in 1,257 Posts
    Images: 1

    Re: I Attended the HR2811 Hearing on July 29th

    Quote Originally Posted by asplundii View Post
    You presume to know me. Never once have I said these bills are going to be argued away. I have felt and still feel that we have been playing a game of catch up for too damn long.
    Actually, I don't know you and presume nothing. The "you" in my post was everyone who would rather argue than do something constructive. If you fit this description - then I am not sorry. I you do not - my sincere apologies.

    Quote Originally Posted by asplundii View Post
    I am sick to death of all these people who talk about how they saw this coming and use every opportunity to say that. Great, you saw it coming... What the heck were you doing about it back then other than seeing it coming? A Cassandra Complex does not do us any good. So you saw it coming. And yet you did nothing about it back when you saw it coming. You are just as guilty for this mess we are in as the rest of us so take that finger you are pointing at us and turn it right back on yourself.
    Not only have I been spouting off my dire prediction of doom for awhile, I have actually tired to do something about it. Believe me, any attempts to self-regulate in this industry have fallen on deaf ears. Go ask PIJAC about how they are being rewarded by the Reptile Nation for trying to be proactive and kick-start some self-regulation. It has been met with contempt and suspicion. There's a healthy tin-foil hat contingent in this hobby that refuses to take any responsibility for their actions and throws hissy-fits any time we try self-regulation and I am freaking sick of it.

    I'm guilty of many things, but contributing to this mess - no, I'm not guilty of that.

    Quote Originally Posted by asplundii View Post
    , I think that amending legislation is just continuing to play the catch up game. We, as a community need to start making the legislation. We have to start regulating ourselves because that is the surest way to keep others from deciding to step in and regulate us.
    I would direct you to efforts by PIJAC to establish some best management practices and how badly that was received by this community. The complaints ranges from "no way, you can't make us" to "you are trying to open it up to the big box breeders to run us out" to "this is being backed by the Free Masons".

    In other words, people have tried and this community has rejected even the vaguest of efforts to attempt some sort of reform.

    I'm older, I have a good paying job and I can afford whatever permits are required to keep my animals safe and happy. I am not a breeder. In short, any concessions that are made I can weather - but I still stay involved - as it seems, do you.

    As to making legislation....well, I fear that we are incapable of coming to a consensus as a group. USARK's efforts in North Carolina attest to that. Many people in this hobby were miffed at what was legislated there. I think that we are doomed to have laws stuffed down our throats because we are so crappy at uniting and mobilizing - what's going on with AB 1122 in California is an embarrassing testament to that.

  9. #67
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: I Attended the HR2811 Hearing on July 29th

    Quote Originally Posted by Skiploder View Post
    Actually, I don't know you and presume nothing. The "you" in my post was everyone who would rather argue than do something constructive. If you fit this description - then I am not sorry. I you do not - my sincere apologies.
    My apologies as well. Because you opened by quoting my post I assumed that you were directing your reply to me alone.

    Not only have I been spouting off my dire prediction of doom for awhile, I have actually tired to do something about it. Believe me, any attempts to self-regulate in this industry have fallen on deaf ears.
    Again, my apologies. I went off a little half cocked. I have just heard so many people spout the Cassandra line that right now I figure anyone saying "I have seen it coming" is just one more on the list.

    Go ask PIJAC about how they are being rewarded by the Reptile Nation for trying to be proactive and kick-start some self-regulation. It has been met with contempt and suspicion. There's a healthy tin-foil hat contingent in this hobby that refuses to take any responsibility for their actions and throws hissy-fits any time we try self-regulation and I am freaking sick of it.
    I saw what happened with PIJAC and I still see it happening even now. It bothers me but beyond offering up my ideas to and supporting PIJAC and USARK I do not know what to do. I wish I knew why the word "regulation" is looked on with such contempt.

    As to making legislation....well, I fear that we are incapable of coming to a consensus as a group. USARK's efforts in North Carolina attest to that. Many people in this hobby were miffed at what was legislated there. I think that we are doomed to have laws stuffed down our throats because we are so crappy at uniting and mobilizing - what's going on with AB 1122 in California is an embarrassing testament to that.
    I would agree with you. And that is kind of what I was trying to get at. There is enough division in the community right now that we do not need more thrown at us by people without enough knowledge on the topic deciding what ought and ought not be done. That kind of behavior just widens the chasms within the community.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. #68
    BPnet Veteran DutchHerp's Avatar
    Join Date
    05-10-2008
    Location
    Texas
    Posts
    2,315
    Thanks
    605
    Thanked 410 Times in 298 Posts
    Images: 6

    Re: I Attended the HR2811 Hearing on July 29th

    Quote Originally Posted by snakemastercanada View Post
    Here is a link to a bunch of quotes from those people that Dutchherp so idolizes so much .
    http://www.naiaonline.org/body/artic...ightsquote.htm
    16 posts on this board and already judging me.

    Sit back and learn, young grasshopper, and until then don't go posting your opinions around about people on a public board.
    MH

    Who the hell is Pat?

    "Pattimuss doesn't run, he prances most delicately, like a beautiful but sad fairy, winged and capped, curly toed shoes on each foot, dancing on dewdrops while lazy crickets play soft music for him to keep time by...." - Wes

  11. #69
    BPnet Senior Member waltah!'s Avatar
    Join Date
    10-08-2007
    Location
    New England
    Posts
    5,648
    Thanks
    1,483
    Thanked 1,252 Times in 931 Posts
    Images: 8

    Re: I Attended the HR2811 Hearing on July 29th

    Quote Originally Posted by DutchHerp View Post
    16 posts on this board and already judging me.

    Sit back and learn, young grasshopper, and until then don't go posting your opinions around about people on a public board.
    First off, only having 16 posts here has nothing to do with anything. Being new here does not necessarily make that person new to the hobby.
    Secondly, most of what is typed on public boards is opinion. If you open yourself up public opinion, you cannot complain when you start reading them.
    Lastly, when last I checked this was not Dutchherp.net, so everyone here has the right to post their opinions as long as they keep it clean and relevant.
    --Walt

  12. #70
    BPnet Veteran DutchHerp's Avatar
    Join Date
    05-10-2008
    Location
    Texas
    Posts
    2,315
    Thanks
    605
    Thanked 410 Times in 298 Posts
    Images: 6

    Re: I Attended the HR2811 Hearing on July 29th

    Quote Originally Posted by waltah! View Post
    First off, only having 16 posts here has nothing to do with anything. Being new here does not necessarily make that person new to the hobby.
    Secondly, most of what is typed on public boards is opinion. If you open yourself up public opinion, you cannot complain when you start reading them.
    Lastly, when last I checked this was not Dutchherp.net, so everyone here has the right to post their opinions as long as they keep it clean and relevant.
    His opinion of me was wrong, as I don't idolize those folks with the quotes.

    But you're right, opinions are what this board is all about.

    You gotta understand though, that it's not nice to be called ignorant when you want the best for this hobby.
    MH

    Who the hell is Pat?

    "Pattimuss doesn't run, he prances most delicately, like a beautiful but sad fairy, winged and capped, curly toed shoes on each foot, dancing on dewdrops while lazy crickets play soft music for him to keep time by...." - Wes

Page 7 of 8 FirstFirst 12345678 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1