» Site Navigation
1 members and 1,841 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,049
Threads: 249,209
Posts: 2,572,709
Top Poster: JLC (31,651)
Welcome to our newest member, Mikvik
|
-
Registered User
Complex Genetics walk through? - Please
I understand the calculations for basic genetic combinations but I'm having trouble with some of the more complex pairings. If you know how, can you please post a walk through on how to calculate the expected outcomes of complex pairings - such as:
Pewter x Spider =
12.5% Normal
12.5% Spider
12.5% Pastel
12.5% Cinny
12.5% Bee (Pastel Spider)
12.5% Pewter (Pastel Cinny)
12.5% Cinnabee (Cinny Spider)
12.5% Pewter Bee (Pastel Cinny Spider)
Thanks
Chad
-
-
Re: Complex Genetics walk through? - Please
The posted outcomes are correct.... What is it that you are having difficulties with exactly?
The percentages or the actual end result offspring morphs/combos?
1.0: Honey Bee | Lesser | Banana Pastel Enchi | Clown 66% Het Albino
0.1: Kingpin | x2 Mojave | Super Pastel HGW | Albino | Sterling Mojave Pinstripe | GHI Pewter | Pastel Het Clown | Sable 66% Het Clown
-
-
Registered User
Re: Complex Genetics walk through? - Please
I just copied those stats from another post: I would like to understand how to come up with them on my own. How do i set up a matrix or something that shows all the % outcomes. I'm fine with the morph combos but Im having a hard time thinking about the pairings with so many outcomes so I would like to make a matrix where i can break it all down.
Thanks
-
-
Re: Complex Genetics walk through? - Please
I don't know if this will help or not, but NERD has a great section on Genetics here:
http://www.newenglandreptile.com/genetics_intro.html
After reading the intro, there are links to Simple Recessive Genetics 101, Double Recessive Genetics 201, and Co-Dominant/Dominant Genetics 301.
-
-
Re: Complex Genetics walk through? - Please
A really easy way to do it is to look at the odds of each mutation individually and then just multiply them
Spider, Pastel and Cinny are all co-dom, the odds of any one of those genes being passed on is 1 in 2 = 50% = 1/2. So, since we are looking at 3 loci, you have odds of (1/2)(1/2)(1/2) = 1/8 = 12.5%
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Complex Genetics walk through? - Please
http://www.geneticswizard.com/ This website might be of some help, you type in the morphs of the male and female and it will calculate the outcomes , you'll have to be a little specific with it though.
Combo morphs are best broken down when using it so you dont get confused.
ex. Bumble Bee would be entered as Spider and Pastel
Last edited by Meltdown Morphs; 07-31-2009 at 07:20 AM.
0.1 GHI Mojave
0.1 Super special h scaleless
0.1 Desert ghost
1.0 WC Dinker
-
-
Re: Complex Genetics walk through? - Please
Learn Punnet squares, and it will allow you to work everything out.
-
-
Registered User
Re: Complex Genetics walk through? - Please
Last edited by ChadOwens; 08-01-2009 at 12:53 AM.
-
-
Registered User
Re: Complex Genetics walk through? - Please
hmmm... can't get that chart to line up right how do you use the chart function???
-
-
Re: Complex Genetics walk through? - Please
Hi,
I made a post on the table function a little while ago that might help.
How you make it tidy however I have no clue. 
This is what I get when I try to put yours into what I think is the correct forum code.
dr del
Last edited by dr del; 08-01-2009 at 12:43 PM.
Reason: trying to tidy up table
Derek
7 adult Royals (2.5), 1.0 COS Pastel, 1.0 Enchi, 1.1 Lesser platty Royal python, 1.1 Black pastel Royal python, 0.1 Blue eyed leucistic ( Super lesser), 0.1 Piebald Royal python, 1.0 Sinaloan milk snake 1.0 crested gecko and 1 bad case of ETS. no wife, no surprise.
-
The Following User Says Thank You to dr del For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|