» Site Navigation
1 members and 626 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,916
Threads: 249,118
Posts: 2,572,200
Top Poster: JLC (31,651)
|
-
Registered User
Re: Woma hidden gene
so i guess there are no answers just more secrets related to money
-
-
Re: Woma hidden gene
Search the threads for "Hidden Gene Woma" and my user name and you will find more than a few discussions that answer your question.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: Woma hidden gene
**Thread Revival**
Did anything ever come about with this topic? What actually is "The Hidden Gene Woma" and are they really two different lines of the same snake? And if they are, is the "hidden gene" something only the Woma can carry? You would think by now you would have "hidden gene lessers, mojaves, pastels, etc... if not but I have not seen anything like that
________________________________________
CHRIS
Lots of Female BP's for 2011
-
-
Re: Woma hidden gene
 Originally Posted by Monster Dodge
**Thread Revival**
Did anything ever come about with this topic? What actually is "The Hidden Gene Woma" and are they really two different lines of the same snake? And if they are, is the "hidden gene" something only the Woma can carry? You would think by now you would have "hidden gene lessers, mojaves, pastels, etc... if not but I have not seen anything like that 
I got told it goes like this...
someone imports woma
later kevin imports something that looks like woma, calls it woma
breeding shows they are not the same thing, it appear to have a hidden gene
we call it the hidden gene woma, but in truth its just a completely different morph that looks like the orginal woma
homozygous HG woma makes pearl, homozygous woma is not proven.
it appears the hidden gene has latched onto lesser gene, but i thought i've seen some HG woma lessers and then the soul sucker which is a HG woma x HG lesser. so I don't understand how that works exactly.
ok now someone correct my above statements, like I said I got told this from who knows where, who knows how long ago.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|