» Site Navigation
1 members and 615 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,916
Threads: 249,118
Posts: 2,572,200
Top Poster: JLC (31,651)
|
-
Re: Repticon Atlanta - August 1st and 2nd
Just thought I'd bump this, since it's just a few weeks away!
-
-
Re: Repticon Atlanta - August 1st and 2nd
1 More Bump, also who's up for Lunch meet up? I know Justin has also expressed interest in this idea.
-
-
Re: Repticon Atlanta - August 1st and 2nd
I'll be attending Saturday and would love to meet folks for lunch - or meet at the show when doors open, check things out, do lunch and come back again.
-
-
BPnet Veteran
Re: Repticon Atlanta - August 1st and 2nd
My husband and I will be there, we are actually doing a presentation with some of our burms.
-
-
Re: Repticon Atlanta - August 1st and 2nd
thats awesome theresa ill have to try to make it down there
-
-
Registered User
Re: Repticon Atlanta - August 1st and 2nd
I'm coming, bringing a friend from work. Can't wait!
-
-
BPnet Veteran
Re: Repticon Atlanta - August 1st and 2nd
Sweet! My first reptile show! If only I could buy something...(My dad dislikes snakes and, since I'm in high school, I live with him...)
-
-
Re: Repticon Atlanta - August 1st and 2nd
Alright Folks, we're setting up a get together at a local mexican restaurant (details will come once a time is decided) after/during the show. The list of people attending that I have so far are:
rabernet
jkobylka
Deborah
Prototype Pythons
Trey
Beardedragon
Myself
Anyone else want in on the action? It's always a good time and a great way to meet other BP.netters!
-
-
-
-
Re: Repticon Atlanta - August 1st and 2nd
If I see you all around I may swing by for a chat but right now IDK what day/time I will be there so I cannot commit to anything.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|