» Site Navigation
0 members and 703 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,912
Threads: 249,118
Posts: 2,572,194
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
Registered User
Spiders, pinstripes, and womas
Where did they come from? Were they once just dinkers someone proved out? Did we create them through selective breeding of extremely reduced patterns? Or are they an actual species of ball python that could be found in the wild aswell? I have been wondering this for a while and wanted to know if someone could answer. Sorry if this is a noob question
-
-
Re: Spiders, pinstripes, and womas
 Originally Posted by BigLu
Where did they come from? Were they once just dinkers someone proved out? Did we create them through selective breeding of extremely reduced patterns? Or are they an actual species of ball python that could be found in the wild aswell? I have been wondering this for a while and wanted to know if someone could answer. Sorry if this is a noob question
Found in the wild
When you've got 10,000 people trying to do the same thing, why would you want to be number 10,001? ~ Mark Cuban "for the discerning collector"
-
-
Re: Spiders, pinstripes, and womas
They are not a separate species....
These are merely color/pattern mutations that were found in the wild. Much like we as humans vary in eye color and hair color, and facial design, the ball python has many different genetic variations.
1.0: Honey Bee | Lesser | Banana Pastel Enchi | Clown 66% Het Albino
0.1: Kingpin | x2 Mojave | Super Pastel HGW | Albino | Sterling Mojave Pinstripe | GHI Pewter | Pastel Het Clown | Sable 66% Het Clown
-
-
Registered User
Re: Spiders, pinstripes, and womas
Thats crazy, i wonder how often importers get snakes like that
-
-
Re: Spiders, pinstripes, and womas
 Originally Posted by BigLu
Thats crazy, i wonder how often importers get snakes like that
Every morph that is a base morph, which is close to 60 - 70 range, were once found in the wild then imported.
We have merely taken those morphs and made designer combinations with them.
1.0: Honey Bee | Lesser | Banana Pastel Enchi | Clown 66% Het Albino
0.1: Kingpin | x2 Mojave | Super Pastel HGW | Albino | Sterling Mojave Pinstripe | GHI Pewter | Pastel Het Clown | Sable 66% Het Clown
-
-
Re: Spiders, pinstripes, and womas
I know at one time they where digging up and hatching 150,000 wild bred ball python eggs a year. With those kind of numbers you are bound to find a few freaks caused by a single mutated gene (or two in the case of the original Platy).
Someone told me the first spider came in the same year as the first clown, 1989. Can anyone verify that? I know the piebalds took years to get started from the first imports and the Crider too. Also back that long ago there wasn't as much experience to build on or as much cash to motivate not to mention that we forget how hard wild caught adults can be to work with. We have really been incredibly successful at propagating mutations to have so many affordable captive bred animals available now.
I'd be interested to hear the origins of the pinstripe and woma but I'm sure they where originally from an imported animal. Someone should seek out all the originators and get each story and publish a book of ball python morph founder. I bet you could still get pictures of a lot of the founder animals.
-
-
Re: Spiders, pinstripes, and womas
IIRC the original Pin was brought in by BHB
The original Woma was brought in by NERD. IF you are on the BLBC forum there is a thread there that has some background on this.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|