» Site Navigation
1 members and 652 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,912
Threads: 249,118
Posts: 2,572,194
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
BPnet Veteran
-
-
BPnet Veteran
Re: dominant question
Super Spider hasnt been proven yet. Dominant means the "het" looks the same as the "super". Sorry no very good with words sometimes
Danny 
0.1 Awesome Normal! (Lost  )
1.0 Lemon Pastel
1.0 VPI Axanthic
0.1 Spider
0.1 Fire
-
-
BPnet Veteran
-
-
BPnet Veteran
Re: dominant question
 Originally Posted by Qetu
ive been researching but have failed to find what im looking for. first i was intrested to know what spider x spider produces. then i found out they are dominant and only co-doms produce "supers" and i know recessive x recessive produce the same morph 100%. but what does dom x dom produce?
Dominant x dominant just produces dominant--the same phenotype--or normal depending on the gene distribution (like brown eyes x brown eyes = brown eyes in humans). Now, in the case of spiders, it's a little obscure. I think the lethal question may have been answered. I spoke with Kevin from NERD, the reported discoverer and largest producer of spider morphs, and they have not yet produced a spider that has two alleles for spider. In other words, they have not produced a spider that has only spider offspring. So, the evidence is leaning toward a homozygous spider lethality.
Last edited by GenePirate; 07-22-2009 at 10:18 PM.
Reason: add option
-
-
BPnet Veteran
Re: dominant question
The way I came to understand this whole thing was that there are 3 types of genes like this;
Dominant: Het and Super look the same (dont give your self a head ache ). There is a chance for the gene to be carried over or not.
Co-dom: Het and Super look different somewhat. 50% chance the co-dom will carry over and the Super will always carry it selfs over in the Co-dom form.
Recessive: Can only be "seen" in its super form. The super form will always carry over as "het". The het form has a 50% chance to carry over.
Oh man head ache!
Danny 
0.1 Awesome Normal! (Lost  )
1.0 Lemon Pastel
1.0 VPI Axanthic
0.1 Spider
0.1 Fire
-
-
BPnet Veteran
Re: dominant question
 Originally Posted by Danounet
The way I came to understand this whole thing was that there are 3 types of genes like this;
Dominant: Het and Super look the same (dont give your self a head ache  ). There is a chance for the gene to be carried over or not.
Co-dom: Het and Super look different somewhat. 50% chance the co-dom will carry over and the Super will always carry it selfs over in the Co-dom form.
Recessive: Can only be "seen" in its super form. The super form will always carry over as "het". The het form has a 50% chance to carry over.
Oh man head ache!
Yeah, you've got the right idea. Let me put it in different terms.
Gene pairs can be described as het (1) or homo (2).
In the case of dominance, and let's pretend that the spider gene is dominant, then whether or not a spider has one or two, it will still look like a regular spider. With spiders, we don't know because it looks like a homozygous spider does not exist. So, we can only assume it's dominant.
In the case of codominance, one allele (gene) produces one type of morph, and having two alleles for that trait produces something all amped up--like pastels and super pastels. This is the way it is understood in the herp world, but it doesn't translate perfectly into mainstream genetics. That's OK. We're talking about herp morphs.
Recessive genes work ONLY in tandem. That is, in order to see a morph, you must have both alleles.
Last edited by GenePirate; 07-22-2009 at 10:42 PM.
Reason: clarification
-
The Following User Says Thank You to GenePirate For This Useful Post:
-
Re: dominant question
Wouldn't a homozygous lethal mutation be classified as co-dominant because the hets are different than the homozygous, the hets are capable of reproducing? Which also touches on another small point, would woma be considered homozygous lethal even though the homozygous animals live for a while?
-
-
Re: dominant question
By the way, it sounds like pinstripe is the first proven dominant ball python mutation. Breed two pinstripes together and the pinstripe phenotype offspring are 33% chance homozygous pinstripes.
-
-
BPnet Veteran
Re: dominant question
These guys are making it complicated, even though I understand, I'll summarize
Dominant: If you breed a dominant ball python to another dominant ball python, all the babies will be dominant, or have the same mutation as the parents. Super Pastels are dominant because if you breed one to another one, you all get super pastels, see what I am saying?
Co-Dominant: If you breed a Co-Dominant to a Normal, you get 2 Normals and 2 Co-Dominant Genes out of every 4 eggs. But if you breed a co-dominant to another one you get 2 co-dominants, 1 dominant, and 1 normal out of every 4 eggs.Think of Co-dominants to be a "visual het."
Recessive: It is hard to explain recessive, but I will try. When you breed a het recessive morph to another het recessive morph(of the same morph), you will get 1 dominant, 2 het recessives, and 1 normal out of every 4 eggs and the hets and normals would be considered 66% poss. het. If you breed a het recessive to a normal, you will get 2 het recessives and 2 normals out of every 4 eggs and the babies will be considered 50% het. And if you breed a recessive morph to a het recessive morph you will get 2 dominant and 2 hets that will be 100% hets.
Hope I didn't lose you there and that it was easier for you to understand.
Guitars, Reptiles, & Fishing!
1.3.1 Crested Geckos
1.0.0 Nu Ana x Moro Leachianus Gecko
1.0.0 Jungle Carpet Python
1.0.0 Normal Ball Python
1.0.0 Bearded Dragon
& Lots of terrified-snake relatives!
-
-
Re: dominant question
 Originally Posted by RandyRemington
Wouldn't a homozygous lethal mutation be classified as co-dominant because the hets are different than the homozygous, the hets are capable of reproducing?
That would be take on it Randy. There is a super form, it is just lethal.
Which also touches on another small point, would woma be considered homozygous lethal even though the homozygous animals live for a while?
And we call the Woma a co-dom so by the same token we ought to call the Spider a co-dom.
I think the big wrinkle is that the Pearl is the result of Kevin breeding his Type I Woma (aka Hidden Gene Woma) together... And it has just been assumed that the Type II (typical Woma) also produce a lethal super, which may or may not be the case...
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|