» Site Navigation
3 members and 972 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,905
Threads: 249,107
Posts: 2,572,121
Top Poster: JLC (31,651)
|
-
Re: What is a jag sib?
Maybe I am misunderstanding Colin's post, but the way I read it he is saying that the "tick" in any animal, be it jag or normal, is not genetic in nature but just something that is brought about by some kind of stress.
Paraphrasing Colin above:
they do not have any genetically passed expressed neurological conditions. any snake can act like that if... it has nothing to do with the jag gene
(Colin please correct me if I am reading your post wrong.)
If that is the case then it begs the question of, why is there a disproportionatly high number of jag with "ticks" vs. normals? To see that disproportion would mean, if the condition had no genetic link and is merely the result of a "stress", that more jags than normals are being exposed to said stress. I am not saying that jag owners are intentionally causing the stress, just that more jags than normals are being exposed to whatever stress it is that causes the condition. And I find it hard to believe that serious keepers, like the ones who invested high dollars into jags in the early years, would even accidentally allow their jags to encounter a stress event of that magnitude.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: What is a jag sib?
Ah, I see Colin ninja'd me while I was replying to Michael.
I was indeed misunderstanding his initial post. My mistake there. Sorry about that Colin
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
BPnet Veteran
Re: What is a jag sib?
not a problem, like i said, i was not very clear... pretty sure we're all on the same page. you know waaaay more about genetics than i do anyway.
Colin Vestrand
long time keeper and breeder of carpet pythons and other snakes...
-
The Following User Says Thank You to Colin Vestrand For This Useful Post:
-
Re: What is a jag sib?
I thought I heard somewhere that the purity of coastal jags in the US was questioned, so rather than sell "normals" from a coastal jag x coastal as "coastals", they were marked as "jag sibs" so they did not sell animals that might not be pure coastal as such.
-
-
BPnet Veteran
Re: What is a jag sib?
 Originally Posted by mainbutter
I thought I heard somewhere that the purity of coastal jags in the US was questioned, so rather than sell "normals" from a coastal jag x coastal as "coastals", they were marked as "jag sibs" so they did not sell animals that might not be pure coastal as such.
What was being questioned was if the founder jag was pure coastal or not.
The jag sib nomenclature was more for a description of what kind of breeding the animals came from. Hence, you will see, jungle jag sib, ij jag sib, or coastal jag sib (or just jag sib).
-
-
Re: What is a jag sib?
 Originally Posted by Colin Vestrand
pretty sure we're all on the same page.
Definitely all on the same page
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
BPnet Veteran
Re: What is a jag sib?
That video honestly reminds me more of pythons I have seen in respiratory distress (RI problems) than it does of the spiders and jags I have seen spinning. If I were to guess from that video alone, I would say your carpet has an RI, or is experiencing some other type of pain in its mid-body section.
I would like to know more detail about this animal directly from the person that owns it. Like, did that just occur one day, or is it still occurring? Any other info about how the little guy/girl is doing now? That just doesn't look neuro to me because the animal seems to have good head control, the spastic movements seem to be coming from the mid-body section instead...but I very well could be wrong.
Off topic, nice sig line Travis! You are more of a nerd than me (and I mean that in a good way).
Ben (almost PhD)
Last edited by bhmorrill; 06-19-2009 at 01:23 PM.
-
The Following User Says Thank You to bhmorrill For This Useful Post:
-
Re: What is a jag sib?
 Originally Posted by bhmorrill
Off topic, nice sig line Travis! You are more of a nerd than me (and I mean that in a good way).
Ben (almost PhD)
You are on of the few people to get that on their own 
I am fully nerd (I take that in a good way) and proud of it LOL.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|