Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 593

0 members and 593 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,912
Threads: 249,118
Posts: 2,572,195
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Page 2 of 4 FirstFirst 1234 LastLast
Results 11 to 20 of 34
  1. #11
    BPnet Veteran BallPython17's Avatar
    Join Date
    02-10-2008
    Location
    miami, florida
    Posts
    394
    Thanks
    39
    Thanked 26 Times in 22 Posts
    Images: 17

    Re: Woma hidden gene

    Whats this hidden gene guys? I've been trying to figure it out for a while. Cuz when you hit a woma to a woma they make pearls right? Is that the hidden gene? lol. I had a friend ask Amir about the hidden gene, but all he said was womaXwoma= pearl.
    1.0 cinny, 1.0 pastel, 1.2 spider, 0.3 normals, 1.0 mojo, 1.0 albino, 1.0 fire, 1.1 yellowbelly, 1.0 het. pied, 1.0 lesser



  2. #12
    Old enough to remember. Freakie_frog's Avatar
    Join Date
    08-12-2004
    Location
    221b Baker Street
    Posts
    16,636
    Thanks
    462
    Thanked 3,884 Times in 2,148 Posts
    Blog Entries
    2
    Images: 107

    Re: Woma hidden gene

    A hidden gen is a gene that has no visual effect on the original animal but falls on the same allele as other morphs so creating a different looking combo.
    When you've got 10,000 people trying to do the same thing, why would you want to be number 10,001? ~ Mark Cuban
    "for the discerning collector"



  3. #13
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Woma hidden gene

    No one really knows what the hidden gene is. It sems to be an enhancer of sorts, causeing interesting phenotypes but that is all anyone can really say.

    The Pearl has nothing to do with the hidden gene. It is just the name of the lethal super form of woma
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. #14
    BPnet Veteran
    Join Date
    02-04-2008
    Location
    Virginia
    Posts
    306
    Thanks
    42
    Thanked 77 Times in 33 Posts
    Images: 38

    Re: Woma hidden gene

    One idea a friend of ours had is that the soul sucker is a woma lesser with the special crystal gene. The hidden gene in the woma might be the crystal gene/special that the original woma was unknowingly bred to.

    Just a idea, but could have some potential....
    Thanks, Outback Reptiles
    josh@outbackreptiles.com
    703-365-2262 Office
    703-789-1697 Cell

  5. #15
    BPnet Lifer mainbutter's Avatar
    Join Date
    09-30-2008
    Location
    Washington, DC
    Posts
    5,690
    Thanks
    269
    Thanked 1,374 Times in 1,053 Posts
    Images: 7

    Re: Woma hidden gene

    Quote Originally Posted by jnjreptiles View Post
    One idea a friend of ours had is that the soul sucker is a woma lesser with the special crystal gene. The hidden gene in the woma might be the crystal gene/special that the original woma was unknowingly bred to.

    Just a idea, but could have some potential....
    yeah I was thinking the same thing, just a carrier of one of the less common BEL complex genes(or a new one that hasn't been named yet).. phantoms, specials, and maybe some other BEL complex genes might not make a huge visual impact when paired with the woma gene.

  6. #16
    BPnet Lifer mainbutter's Avatar
    Join Date
    09-30-2008
    Location
    Washington, DC
    Posts
    5,690
    Thanks
    269
    Thanked 1,374 Times in 1,053 Posts
    Images: 7

    Re: Woma hidden gene

    Quote Originally Posted by BallPython17 View Post
    Whats this hidden gene guys? I've been trying to figure it out for a while. Cuz when you hit a woma to a woma they make pearls right? Is that the hidden gene? lol. I had a friend ask Amir about the hidden gene, but all he said was womaXwoma= pearl.
    As the story goes(at least as I understand it), NERD paired a woma with a lesser, and a BP hatched out that looked NOTHING like what you'd expect. It was dubbed the "soul sucker". IMO it looks similar to the homozygous form of the "special" morph or "phantom" morph.

    Successive breedings of lessers and womas hatched out what we know of today as lesser-womas, something that DOES look like what you'd expect.

    This lead to speculation that the woma that produced the soul sucker wasn't just a woma.. but since it pretty much looks just like a woma, they called it a "hidden gene woma".

    A lack of tons of information has made things tricky for people to truly understand what is going on here, but it is pretty much assumed by many people, including myself, that what are now called "hidden gene womas"(which when paired with lessers make soul suckers) are combo morphs of woma and a less-than-obvious BEL complex gene that is similar to phantoms or specials.

  7. #17
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Woma hidden gene

    Quote Originally Posted by mainbutter View Post
    A lack of tons of information has made things tricky for people to truly understand what is going on here, but it is pretty much assumed by many people, including myself, that what are now called "hidden gene womas"(which when paired with lessers make soul suckers) are combo morphs of woma and a less-than-obvious BEL complex gene that is similar to phantoms or specials.
    I agree on the total lack of information making it tricky.

    Somewhere on these boards I commented that RDRs hidden gene and the woma hidden gene were related and someone told me I was totally incorrect on that. I was told that the hidden gene in woma is not related to the BluEL group because the SoulSucker is homozygous for hidden... I wish like nothing else I could find that thread but my searches so far are coming up empty... I'll keep trying
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  8. #18
    BPnet Veteran LGL's Avatar
    Join Date
    11-25-2006
    Location
    Colorado
    Posts
    1,068
    Thanks
    127
    Thanked 199 Times in 173 Posts
    Images: 72

    Re: Woma hidden gene

    Quote Originally Posted by asplundii View Post
    I agree on the total lack of information making it tricky.

    Somewhere on these boards I commented that RDRs hidden gene and the woma hidden gene were related and someone told me I was totally incorrect on that. I was told that the hidden gene in woma is not related to the BluEL group because the SoulSucker is homozygous for hidden... I wish like nothing else I could find that thread but my searches so far are coming up empty... I'll keep trying
    That would make sense because if the hidden gene was part of the BEL complex, then a Woma Hidden-Gene Lesser combo (Soul Sucker) would, in theory, produce a BEL... A snake with two allels of the BEL complex produces a white snake. (in this case Lesser and Hidden-Gene, if the Hidden Gene was a part of the complex).

    Hmmmm......
    Eric Wilson
    UltimateHerps
    www.ultimateherps.com

  9. #19
    BPnet Lifer mainbutter's Avatar
    Join Date
    09-30-2008
    Location
    Washington, DC
    Posts
    5,690
    Thanks
    269
    Thanked 1,374 Times in 1,053 Posts
    Images: 7

    Re: Woma hidden gene

    Quote Originally Posted by LGL View Post
    A snake with two allels of the BEL complex produces a white snake.
    not entirely true.

    homozygous mojaves have greyed heads.

    phantom-lessers make white snakes(I believe), but super phantoms have distinct coloration and patterning to them.

    I'm not 100% up to par on the history of the "special"(another BEL complex gene), but from what I understand the special-mojo combo makes the "crystal", which is definitely not an all white snake.

    butters and lessers are what people typically think of when they think of "BEL complex", and the homozygous forms are pretty much all white snakes with blue eyes, but there is so much more to the BEL complex than butters and lessers.

  10. The Following User Says Thank You to mainbutter For This Useful Post:

    LGL (06-18-2009)

  11. #20
    BPnet Lifer mainbutter's Avatar
    Join Date
    09-30-2008
    Location
    Washington, DC
    Posts
    5,690
    Thanks
    269
    Thanked 1,374 Times in 1,053 Posts
    Images: 7

    Re: Woma hidden gene

    also does anyone know if the original soul sucker carries the woma gene? in theory, a hidden gene woma, if my understanding of the genetics behind it is correct, when paired with a lesser, can produce a hidden gene-lesser combo, and a hidden gene-woma-lesser combo (and other possibilities that don't pertain to my question).

    Looking at the soul sucker, I could see it going either way as far as whether or not it actually carries the woma gene.

Page 2 of 4 FirstFirst 1234 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1