Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 744

0 members and 744 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,107
Posts: 2,572,120
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Page 1 of 2 12 LastLast
Results 1 to 10 of 18
  1. #1
    Registered User
    Join Date
    04-28-2009
    Posts
    79
    Thanks
    0
    Thanked 1 Time in 1 Post

    What is a jag sib?

    this has to do with carpets, what's a jag sib?

  2. #2
    Registered User
    Join Date
    03-30-2009
    Posts
    423
    Thanks
    157
    Thanked 43 Times in 41 Posts

    Re: What is a jag sib?

    this is just a guess, i'm not way into carpets....

    jaguar *i think* is recessive, jag sibs are hets for jag. apparently many jags and jag sibs have built in nuero issues, such as the jag sib i have. at first glance, mine seems to be in death throes, but he eats vigorously, just has a hard time with coordination and body control.

    why are you asking?

  3. #3
    BPnet Veteran Lucas339's Avatar
    Join Date
    10-08-2008
    Location
    Fort Pierce
    Posts
    2,104
    Thanks
    158
    Thanked 389 Times in 366 Posts
    Images: 2

    Re: What is a jag sib?

    this question was already answered in the other thread you started!!!
    http://www.ball-pythons.net/forums/s...ad.php?t=92279

  4. #4
    Telling it like it is! Stewart_Reptiles's Avatar
    Join Date
    09-28-2006
    Posts
    24,845
    Thanks
    6,116
    Thanked 20,811 Times in 9,584 Posts
    Blog Entries
    1
    Images: 6

    Re: What is a jag sib?

    Quote Originally Posted by Ben Biscy View Post
    this is just a guess, i'm not way into carpets....

    jaguar *i think* is recessive, jag sibs are hets for jag. apparently many jags and jag sibs have built in nuero issues, such as the jag sib i have. at first glance, mine seems to be in death throes, but he eats vigorously, just has a hard time with coordination and body control.

    why are you asking?
    The Jaguar is a co-dom
    Deborah Stewart


  5. #5
    BPnet Veteran MPenn's Avatar
    Join Date
    08-31-2006
    Location
    East Texas
    Posts
    1,877
    Thanks
    94
    Thanked 114 Times in 103 Posts
    Images: 2

    Re: What is a jag sib?

    Quote Originally Posted by Ben Biscy View Post
    this is just a guess, i'm not way into carpets....

    jaguar *i think* is recessive, jag sibs are hets for jag. apparently many jags and jag sibs have built in nuero issues, such as the jag sib i have. at first glance, mine seems to be in death throes, but he eats vigorously, just has a hard time with coordination and body control.

    why are you asking?
    The jag gene is a co-dom. The jag sib just refers to a normal in the clutch that does not carry the jaguar gene. Kind of like pastel ball sibs.
    At one time, there was a belief that there was some magic in the sibs but has since been debunked.

    And by the way, the sibs do not have neuro issues. I have no idea where you are getting your info.

  6. #6
    Registered User
    Join Date
    03-30-2009
    Posts
    423
    Thanks
    157
    Thanked 43 Times in 41 Posts

    Re: What is a jag sib?

    Quote Originally Posted by MPenn View Post
    The jag gene is a co-dom. The jag sib just refers to a normal in the clutch that does not carry the jaguar gene. Kind of like pastel ball sibs.
    At one time, there was a belief that there was some magic in the sibs but has since been debunked.

    And by the way, the sibs do not have neuro issues. I have no idea where you are getting your info.
    explain this one. he's eating fine, growing well, in shed right now. eating small mice weekly. stress him out and this is what you get....

    YouTube - jungle carpet is sick

    if that's not a nuero issue i don't know what is. however, i have minimal experience with carpets, i've never raised or collected them until this one, and i haven't gotten any more BECAUSE of this one. i saw another video of a breeder who had a jag with pretty severe nuero issues when stressed, in the video he showed it combating with another male, flipping upside down, over reaching, etc. basically just like mine, but adult instead of baby.

    i get my info from drawing conclusions based on the things i see and the information i'm exposed to. two and two usually ends up being four.

  7. #7
    BPnet Veteran Colin Vestrand's Avatar
    Join Date
    09-28-2005
    Location
    kalamazoo, mi
    Posts
    1,691
    Thanks
    32
    Thanked 162 Times in 127 Posts
    Images: 70

    Re: What is a jag sib?

    what michael meant was that they do not have any genetically passed expressed neurological conditions. any snake can act like that if you drop them, expose them to high heat, chemicals, etc... or if they're just born with a defect.

    it has nothing to do with the jag gene... they're just normal carpets.
    Colin Vestrand

    long time keeper and breeder of carpet pythons and other snakes...

  8. The Following User Says Thank You to Colin Vestrand For This Useful Post:

    Ben Biscy (06-16-2009)

  9. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: What is a jag sib?

    Quote Originally Posted by Colin Vestrand View Post
    what michael meant was that they do not have any genetically passed expressed neurological conditions. any snake can act like that if you drop them, expose them to high heat, chemicals, etc... or if they're just born with a defect.

    it has nothing to do with the jag gene... they're just normal carpets.
    If that is the case then why do so many jags seem to have this "tick" while relatively few normals have it? What are so many jag owners doing wrong to induce the condition that normal owners are not doing? And why, when jags cost $1-5k a few years ago, were serious keepers doing anything with such expensive animals that might put their animals at risk?
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. #9
    BPnet Veteran MPenn's Avatar
    Join Date
    08-31-2006
    Location
    East Texas
    Posts
    1,877
    Thanks
    94
    Thanked 114 Times in 103 Posts
    Images: 2

    Re: What is a jag sib?

    Quote Originally Posted by asplundii View Post
    If that is the case then why do so many jags seem to have this "tick" while relatively few normals have it? What are so many jag owners doing wrong to induce the condition that normal owners are not doing? And why, when jags cost $1-5k a few years ago, were serious keepers doing anything with such expensive animals that might put their animals at risk?
    No one is for sure why the jags have this "tick". It is believed to be similar to the spider ball. Both have a lethal super and the het (ie. jag and spider) is a carrier.
    I will add that not all jags exhibit this behavior. It has been concluded that it can be brought on by stress (ie. chemicals, high heat, combatting).
    I am not sure where you think that jag owners are doing something intentionally to produce bobble-head jags. Read above.

  11. #10
    BPnet Veteran Colin Vestrand's Avatar
    Join Date
    09-28-2005
    Location
    kalamazoo, mi
    Posts
    1,691
    Thanks
    32
    Thanked 162 Times in 127 Posts
    Images: 70

    Re: What is a jag sib?

    Quote Originally Posted by asplundii View Post
    If that is the case then why do so many jags seem to have this "tick" while relatively few normals have it? What are so many jag owners doing wrong to induce the condition that normal owners are not doing? And why, when jags cost $1-5k a few years ago, were serious keepers doing anything with such expensive animals that might put their animals at risk?
    i only meant it was not genetic as far as the jag SIBS go... i should have been more clear. i agree that jags, themselves, have issues.
    Colin Vestrand

    long time keeper and breeder of carpet pythons and other snakes...

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1