Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 742

0 members and 742 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,909
Threads: 249,112
Posts: 2,572,157
Top Poster: JLC (31,651)
Welcome to our newest member, KoreyBuchanan
Page 3 of 6 FirstFirst 123456 LastLast
Results 21 to 30 of 58

Thread: Swine Flu

  1. #21
    BPnet Veteran _Venom_'s Avatar
    Join Date
    12-27-2007
    Location
    Chicago
    Posts
    725
    Thanks
    51
    Thanked 56 Times in 32 Posts

    Re: Swine Flu

    What's with people saying they ate pig?
    It's not transferable by eating pig, or even touching pig.

    It's a human to human thing.
    www.scorpionforum.darkbb.com
    myspace.com/aztekvamp

  2. #22
    BPnet Senior Member Mike Cavanaugh's Avatar
    Join Date
    12-23-2007
    Location
    jacksonville, fl
    Posts
    3,431
    Thanks
    623
    Thanked 1,022 Times in 458 Posts
    Images: 2

    Re: Swine Flu

    Quote Originally Posted by eulenspiegel View Post
    I ate some really yummy bacon with my eggs this morning. I haven't died yet so I am guessing that is a good sign.
    A 23 month old baby died from this in Texas today (maybe one of your neighbors?). Possibly HUNDREDS of children have it in NY. laugh it up.
    Last edited by Mike Cavanaugh; 04-29-2009 at 07:36 AM.
    Mikey Cavanaugh
    (904) 318-3333

  3. #23
    Apprentice SPAM Janitor MarkS's Avatar
    Join Date
    07-22-2005
    Location
    St Paul, MN
    Posts
    6,209
    Thanks
    1,535
    Thanked 2,678 Times in 1,596 Posts
    Blog Entries
    9
    Images: 3

    Re: Swine Flu

    According to the CDC, about 36 THOUSAND people in the U.S. die ANNUALLY from flu related causes.

    So, how is this so different from every other year?
    Draco dormiens nunquam titillandus

  4. #24
    BPnet Senior Member Mike Cavanaugh's Avatar
    Join Date
    12-23-2007
    Location
    jacksonville, fl
    Posts
    3,431
    Thanks
    623
    Thanked 1,022 Times in 458 Posts
    Images: 2

    Re: Swine Flu

    Quote Originally Posted by MarkS View Post
    According to the CDC, about 36 THOUSAND people in the U.S. die ANNUALLY from flu related causes.

    So, how is this so different from every other year?
    Yep, ONLY 36 ThOUSAND people die anually from flu related causes because a large number of people, who are particularly vulnerable, get a FLU SHOT... Something that is not available for this flu, and wont be for months.
    Mikey Cavanaugh
    (904) 318-3333

  5. #25
    BPnet Veteran Coils's Avatar
    Join Date
    09-24-2008
    Location
    Indiana
    Posts
    256
    Thanks
    161
    Thanked 46 Times in 36 Posts
    Images: 14

    Re: Swine Flu

    I must say it does scare me a little bit, since a few other outbreaks in the past killed quite a few people(according to what I have read diff places), but it is a different time now and, yes, I have heard a bunch about the media doing anything they can to really scare people about the whole thing and whats currenetly happening.

    What worries me RIGHT now is that two cases were found not far down the road from where I am and my brother and sister are still in school who are in areas where it really could get spread around and rather quickly IF it happens. (more worried about them, not it coming back to myself)

    So I can say it is starting to make me nervous and I really hope it doesn't get completely out of hand, (have heard multiple things about the actual number of deaths in mexico) but I am not freaking JUST yet.
    A Girl with some Balls

    0.1 BEL 1.0 Mojo 0.1 Pastel 1.0 Normal 1.0 Spider 0.1 Leopard gecko 0.1 Redtail Boa 0.0.1 Red Eyed Croc Skink Many Hissing Roaches

  6. #26
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Swine Flu

    Quote Originally Posted by Jyson View Post
    Wasn't they dealing with the spanish flu in 1918? I think was one the one that took thousands of lives (in europe) but perhaps that one crossed over to America?
    Yes the "Spanish" Flu was 1918/19 but it was a global pandemic that circled the globe no less than 3 times hitting every continent. And significantly more than a few thousand people died.

    Quote Originally Posted by Mike Cavanaugh View Post
    What puzzles me about it is the deaths in mexico compared to the lesser effect in the United States. I have read several articles that point out how obviously the US has better healthcare, but I haven't found anyone yet that says better healthcare is the the reason they are dying over there, and just getting sick here. Most articles flat out say they don't know why it is ending in death in Mexico.
    I would say health care is a pretty big sticking point. If you do not have the infrastructure and the supplies to support those that are ill then they are going to suffer more compared to those that do have the infrastructure.

    There is also another factor that may be contributing to a higher level of "pre-immunity" here but I'll not bog people down in the details of that because I am sure that the majority of you do not care

    I am no scientific guru by any means, so my uneducated common sense tells me that maybe there are two different strains of the virus.... the one that it killing people in Mexico, and the weaker one that is just making people sick here.
    It is all one strain, they have typed it already so they know that the cases in Mexico are caused by the same strain as the cases here and in Europe and in Aus/NZ.

    Anyways, can someone please tell me why we aren't tightening up our borders until we have this whole thing figured out?!
    We are actually

    Quote Originally Posted by Mike Cavanaugh View Post
    At a time when Obama will be criticized for every penny spent, him asking for 1.5 billion to fight swine flu shows me it is something the administration (who knows way more then any of us) is taking it VERY seriously.
    There is a bit of a fallacy in that logic. Huge amounts of money were thrown into the "avian" flu which has gone all of nowhere in terms of being the next great lethal pandemic. This is part of the hype, people get scared cause the media starts throwing out questionable "facts" and then the public wants the scientists to save to world. And the scientists are not going to say no to "free" money to do more research.

    Quote Originally Posted by MarkS View Post
    According to the CDC, about 36 THOUSAND people in the U.S. die ANNUALLY from flu related causes.

    So, how is this so different from every other year?
    Quote Originally Posted by Mike Cavanaugh View Post
    Yep, ONLY 36 ThOUSAND people die anually from flu related causes because a large number of people, who are particularly vulnerable, get a FLU SHOT... Something that is not available for this flu, and wont be for months.
    And flu season is about to end here at which this flu will go to ground for the season and they will use the summer to make next year's flu vaccine (like they always do) and one component in that vaccine will be against this strain so that when flu season begins again, when/if this strain comes back, the vaccine will confer protection against it.

    Mark is correct to ask how this is different than any other year. There is a good chance it is not any different. It is just that a strain that was not covered by this past years vaccine is popping up at the end of the season so no one has any type of exposure to it. This happens all the time, it just does not always happen in a place where the infrastructure allows for a rapid explosion of cases like this one did.


    At the end of the day it is still too early to say what exactly will happen with this. The best thing to do is just be prudent, wash you hands, don't cough on your neighbors and not buy into the hype.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Beardedragon (05-03-2009),Jyson (05-07-2009)

  8. #27
    BPnet Veteran Ginevive's Avatar
    Join Date
    02-15-2004
    Location
    West Seneca, New York
    Posts
    11,728
    Thanks
    216
    Thanked 144 Times in 117 Posts
    Images: 40

    Re: Swine Flu

    Human overpopulation, and huge factory farming, leads to these kinds of outbreaks, in my opinion. I am traveling to southern cali this autumn; I have no plans to change my itinerary. For one, my area here in NY, is full of farms where countless Mexican immigrants come seasonally to work. And I have already heard of cases of the flu in NY. So, I see no real difference in my chances of catching it, if I stay home, versus if I travel. I wanted to go to Mexico, but we changed our plans because of the unrest and upheval on the mex-US border; a very real danger.
    I know that many people argue that we as a country, should keep our money here, and stop helping foreign nations. But personally, I think that we should financially assist Mexico in their dealings with this virus; we are intertwined and viruses do not respect manmade borders. And they need help. I really don't know what the correlation is, between US citizens mainly just getting sick from this; and Mexicans dying.. but it is something that I want to look into.

    A little aside; I really wish that people as a whole, were neater and cleaner. I can't count how many times I'm in a bathroom stall, and hear people flush and just walk out. Or don't even bother to flush. Personally, I am a down-dirty country girl; but I still wash my hands well and use a paper towel to open doors at work where there are many people.. because many people don't! I'd seriously rather spend a day mucking out horse stalls, as opposed to dealing with human filth!
    Last edited by Ginevive; 05-02-2009 at 02:44 PM.
    -Jen. Back in the hobby after a hiatus!
    Ball pythons:
    0.1 normal; 1.1 albino. 1.0 pied; 0.1 het pied; 1.0 banana.

  9. #28
    Registered User
    Join Date
    01-30-2009
    Location
    St.Catharines,Ontario
    Posts
    395
    Thanks
    2
    Thanked 20 Times in 20 Posts

    Re: Swine Flu

    We are now at L 5 said who!!!!!!!!!!! Close your doors and hope for the best. This is going to hit hard but atleast schools will be out soon for the summer. My kids will be in summer camps
    Too many pets to list!

  10. #29
    BPnet Veteran DutchHerp's Avatar
    Join Date
    05-10-2008
    Location
    Texas
    Posts
    2,315
    Thanks
    605
    Thanked 410 Times in 298 Posts
    Images: 6

    Re: Swine Flu

    This is not an aggressive strain of flu... the media is making it a big deal while it's probably not.

    I still think we should be be cautious, but there's not need for panic.

    BTW, a guy on the Morelia Forums has swine flu, or so I've read at least.
    MH

    Who the hell is Pat?

    "Pattimuss doesn't run, he prances most delicately, like a beautiful but sad fairy, winged and capped, curly toed shoes on each foot, dancing on dewdrops while lazy crickets play soft music for him to keep time by...." - Wes

  11. #30
    Registered User
    Join Date
    01-30-2009
    Location
    St.Catharines,Ontario
    Posts
    395
    Thanks
    2
    Thanked 20 Times in 20 Posts

    Re: Swine Flu

    The big thing with this flu isn't that it's bad but it's a mixure they have never seen before! This you tube video is interesting: YouTube - Why we have virus outbreaks & how we can prevent them
    Too many pets to list!

Page 3 of 6 FirstFirst 123456 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1