Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,069

1 members and 1,068 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,945
Threads: 249,141
Posts: 2,572,339
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Page 2 of 6 FirstFirst 123456 LastLast
Results 11 to 20 of 58

Thread: Swine Flu

  1. #11
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Swine Flu

    Quote Originally Posted by MarkS View Post
    I was 18 when the last swine flu panic went around in the US. This was back in 1976/1977 or somewhere around there I think... The weird part was that I don't think there was even a confirmed case of swine flu in the US. I think after all was said and done, more people were killed or injured during the vaccination process then there were people who came down with the swine flu.
    Not wholly accurate. There were cases here in the States and the numbers were pretty high vs. "typical" seasonal flu but nothing near the 1918/19 one.

    Quote Originally Posted by Ben Biscy View Post
    if we end up facing a pandemic i believe it'll be a bit more dramatic than a mere flu variant....
    This one actually has a lot of potential to go full on pandemic and it is just a "mere flu variant", just an interesting chimeric one, not that that is too unusual either.

    Long and short is that right now we are too early in the game to say just what is going to happen with it. I agree the media is hyping the heck out of this one like they always do. That said, the micro community is paying a lot more attention to this one than the avian bird flu that was all the news a few years ago and there are good reasons for that closer attention. Right now, I think it bears watching but the time for stockpiling the survival shelter is not even close to here.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. #12
    Apprentice SPAM Janitor MarkS's Avatar
    Join Date
    07-22-2005
    Location
    St Paul, MN
    Posts
    6,209
    Thanks
    1,535
    Thanked 2,678 Times in 1,596 Posts
    Blog Entries
    9
    Images: 3

    Re: Swine Flu

    Quote Originally Posted by asplundii View Post
    Not wholly accurate. There were cases here in the States and the numbers were pretty high vs. "typical" seasonal flu but nothing near the 1918/19 one.
    Do you know what the actual numbers were? I don't actually remember any cases where they confirmed that it was swine flu, but this is over 30 years ago and I'm just going by memory. I got curious and have been searching online too but haven't found much of anything yet. I know that there were a dozen people dead and a couple of hundred paralyzed from Guillain-Barre syndrome that was blamed on the vaccinations.
    Draco dormiens nunquam titillandus

  3. #13
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Swine Flu

    Do not know the numbers of the top of my head but I can hunt through my old files and see. There were a number of GB cases that were linked to the vaccination, that I do recall.

    The whole name "swine flu" is a misnomer in this case and in the '77 pandemic as neither were transmitted to humans by swine (or any other animal for that matter.) The "swine" comes into play because of the history and evolution of the flu. Certain strains of flu normally circulate in swine and those same strains can infect humans (the '77 pandemic was H1N2 IIRC which is one of these.) Genetic level analysis of this particular strain indicates that some of the components of this strain are similar to those that have traditionally been found in swine populations. However since it is still too early to tell how this particular strain got into the human population so we do not know just what it is really. But by all accounts there apparently is no history of swine exposure at all, it has all been human to human. Technically the 1918 flu was a swine flu as well though we all know it as Spanish flu (which is also an odd one to me considering it originated in a military base in Kansas...)
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. The Following User Says Thank You to asplundii For This Useful Post:

    MarkS (04-28-2009)

  5. #14
    BPnet Veteran Lucas339's Avatar
    Join Date
    10-08-2008
    Location
    Fort Pierce
    Posts
    2,104
    Thanks
    158
    Thanked 389 Times in 366 Posts
    Images: 2

    Re: Swine Flu

    thats it....time to ban pigs!!

  6. #15
    BPnet Veteran Jyson's Avatar
    Join Date
    08-07-2008
    Location
    Brooksville, FL
    Posts
    2,615
    Thanks
    1,487
    Thanked 577 Times in 518 Posts
    Images: 9

    Re: Swine Flu

    Quote Originally Posted by Lucas339 View Post
    thats it....time to ban pigs!!


    There were cases here in the States and the numbers were pretty high vs. "typical" seasonal flu but nothing near the 1918/19 one.
    Wasn't they dealing with the spanish flu in 1918? I think was one the one that took thousands of lives (in europe) but perhaps that one crossed over to America?

  7. #16
    BPnet Senior Member Mike Cavanaugh's Avatar
    Join Date
    12-23-2007
    Location
    jacksonville, fl
    Posts
    3,431
    Thanks
    623
    Thanked 1,022 Times in 458 Posts
    Images: 2

    Re: Swine Flu

    I honestly think it is a lot bigger and nastier then most people think. time will tell.

    What puzzles me about it is the deaths in mexico compared to the lesser effect in the United States. I have read several articles that point out how obviously the US has better healthcare, but I haven't found anyone yet that says better healthcare is the the reason they are dying over there, and just getting sick here. Most articles flat out say they don't know why it is ending in death in Mexico.

    I am no scientific guru by any means, so my uneducated common sense tells me that maybe there are two different strains of the virus.... the one that it killing people in Mexico, and the weaker one that is just making people sick here.

    Anyways, can someone please tell me why we aren't tightening up our borders until we have this whole thing figured out?!
    Mikey Cavanaugh
    (904) 318-3333

  8. #17
    BPnet Senior Member Mike Cavanaugh's Avatar
    Join Date
    12-23-2007
    Location
    jacksonville, fl
    Posts
    3,431
    Thanks
    623
    Thanked 1,022 Times in 458 Posts
    Images: 2

    Re: Swine Flu

    At a time when Obama will be criticized for every penny spent, him asking for 1.5 billion to fight swine flu shows me it is something the administration (who knows way more then any of us) is taking it VERY seriously.
    Mikey Cavanaugh
    (904) 318-3333

  9. #18
    BPnet Veteran _Venom_'s Avatar
    Join Date
    12-27-2007
    Location
    Chicago
    Posts
    725
    Thanks
    51
    Thanked 56 Times in 32 Posts

    Re: Swine Flu

    Yeah...
    It's still pretty early.

    Also(Like in other pandemics) it could die in the summer but re-emerge in the fall like the regular flu with a bigger hysteria.

    And to why it is worse in Mexico is still a mystery(Official report)
    www.scorpionforum.darkbb.com
    myspace.com/aztekvamp

  10. #19
    BPnet Senior Member Mike Cavanaugh's Avatar
    Join Date
    12-23-2007
    Location
    jacksonville, fl
    Posts
    3,431
    Thanks
    623
    Thanked 1,022 Times in 458 Posts
    Images: 2

    Re: Swine Flu

    yeah, 60 people have it so far in the US, and apparently they are all recovering. The president is asking for 1.5 billion. Either Obama plans to give each of the 60 suffering with the swine flew $25,000,000.00 each, or they are expecting much much worse to come.
    Mikey Cavanaugh
    (904) 318-3333

  11. #20
    Account Disabled
    Join Date
    01-11-2009
    Posts
    397
    Thanks
    69
    Thanked 67 Times in 46 Posts

    Re: Swine Flu

    I ate some really yummy bacon with my eggs this morning. I haven't died yet so I am guessing that is a good sign.

Page 2 of 6 FirstFirst 123456 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1