» Site Navigation
2 members and 590 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,912
Threads: 249,117
Posts: 2,572,189
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
Registered User
question on a cross....
yellow belly x normal = what?
-
-
Re: question on a cross....
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Registered User
Re: question on a cross....
so yb is a dominant trait? thank you for the reply!
-
-
Re: question on a cross....
 Originally Posted by Ben Biscy
yellow belly x normal = what?
50% Normal + 50% YB
 Originally Posted by Ben Biscy
so yb is a dominant trait? thank you for the reply!
YB is a co-dom the super is the Ivory
-
The Following User Says Thank You to Stewart_Reptiles For This Useful Post:
-
Registered User
Re: question on a cross....
 Originally Posted by Deborah
50% Normal + 50% YB
YB is a co-dom the super is the Ivory
thanks a bunch!
next question.... what are the exact markers for the yb's vs normals? i see the checker from the belly part, but the yb is very normal looking. any tips on how to see the difference easily and without a doubt?
-
-
BPnet Veteran
Re: question on a cross....
This link will provide all your answers ;
http://www.nextworldexotics.com/hgyb.htm
-
The Following User Says Thank You to RegiusCo For This Useful Post:
-
Registered User
Re: question on a cross....
i asked this once and someone said
"a yellow belly"
and i laughed, and if you see one in person you will laugh too because it has a distinct difference.
-
-
Registered User
Re: question on a cross....
 Originally Posted by dsmalex97
i asked this once and someone said
"a yellow belly"
and i laughed, and if you see one in person you will laugh too because it has a distinct difference. 
i got one yesterday. very subtle mutation to say the least; at a glance they look like normals.
funniest part is a couple of my normals have the same traits...
-
-
Re: question on a cross....
 Originally Posted by Ben Biscy
i got one yesterday. very subtle mutation to say the least; at a glance they look like normals.
funniest part is a couple of my normals have the same traits... 
Lets see some pics.
Eddie Strong, Jr. 
-
-
Registered User
Re: question on a cross....
 Originally Posted by Wh00h0069
Lets see some pics.
cam's in the truck, truck's on the road. pix later.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|