Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 637

0 members and 637 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,105
Posts: 2,572,111
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Results 1 to 2 of 2
  1. #1
    BPnet Veteran Jyson's Avatar
    Join Date
    08-07-2008
    Location
    Brooksville, FL
    Posts
    2,615
    Thanks
    1,487
    Thanked 577 Times in 518 Posts
    Images: 9

    Question What to Write in a Letter Opposing the Ban?

    I have been reading a few posts on HR 669, and I am ready to write my letter on why I am against this ban. However, I am at a lose, I am unsure about what to say exactly and how I should word it. So I was hoping that some of yall who have already written yours could share some inspiration on what exactly should one say.

  2. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: What to Write in a Letter Opposing the Ban?

    The bulleten put out by USARK has an okay sample letter (that bulleten has been quoted in full ere a couple places) use that as a template and then just flesh out other things you feel you need to say

    Just remember, above all, do not be offensive or rude. The instant you do that is the instant you lose an audience.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1