» Site Navigation
0 members and 606 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,916
Threads: 249,118
Posts: 2,572,200
Top Poster: JLC (31,651)
|
-
Registered User
what is het Russo & white diamond?
What is a White Diamond and what is a Russo? Im sure they are no special snakes that I've never seen yet but the fancy names got me confused..
Like I see snakes for sale that says het Russo, het white diamionds... What are these? Im thinking they are just leucies.
-
-
Re: what is het Russo & white diamond?
Yeah they are one of the BluEL group. The lucie is the White Diamond. the het Russo is, well, the het form...
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Registered User
Re: what is het Russo & white diamond?
Thanks. I knew it was some stupid crap like that. STUPID!!
thank you
-
-
Re: what is het Russo & white diamond?
???
Why Stupid?
Vin worked hard to prove it out.
They are special. They make a white snake...
-
The Following User Says Thank You to LadyOhh For This Useful Post:
-
Re: what is het Russo & white diamond?
Vin Russo had some brightly colored ball pythons that he was working with that he called his lemon balls? When breeding two of these together he produced a leucistic ball python that he called the white diamond. Most people that I hear talking about them now call hets from his line 'Het Russos' instead of Lemon balls.
I think he was one of the very first, if not THE first, to produce a leucistic ball python.
Draco dormiens nunquam titillandus
-
-
Re: what is het Russo & white diamond?
Doesn't the Russo produce a black eyed lucie not blue???
~*Rich
1.0 100% Het Albino
1.3 Normal
1.0 Spider
0.1 Mojave
1.0 Pastel 100% Het Goldfinger
0.1 Pastel 66% Het Goldfinger
0.1 Pastel PH Goldfinger

-
-
Re: what is het Russo & white diamond?
 Originally Posted by Spaniard
Doesn't the Russo produce a black eyed lucie ???
No, it's one of the blue eyed complex.
Draco dormiens nunquam titillandus
-
The Following 2 Users Say Thank You to MarkS For This Useful Post:
Greensleeves001 (06-22-2016),Spaniard (04-03-2009)
-
Re: what is het Russo & white diamond?
Ahhhh thank you, can't keep up with all dem white snake makers
~*Rich
1.0 100% Het Albino
1.3 Normal
1.0 Spider
0.1 Mojave
1.0 Pastel 100% Het Goldfinger
0.1 Pastel 66% Het Goldfinger
0.1 Pastel PH Goldfinger

-
-
Re: what is het Russo & white diamond?
 Originally Posted by t-Roy
Thanks. I knew it was some stupid crap like that. STUPID!!
Not really sure where that's coming from. Het Russo, Russo Het Leucistic and Het White Diamond are all names referring to a specific mutation/trait.
White Diamond is a name referring to a specific variety of Blue eyed Leucistic.
Vin Russo is the founder of these animals and has every right to call them what he wishes.
Nothing STUPID about it.
-
The Following 2 Users Say Thank You to Louis Kirkland For This Useful Post:
amozo (02-10-2015),Greensleeves001 (06-22-2016)
-
Registered User
Re: what is het Russo & white diamond?
Oh so Russo is a person!! lol!! ok now I see... Im a noob guys. There might be some stupid things coming from me, so please excuse me
So who's white Diamond?? haha j/k.. But who made up that name though for real.
I know that mojave, butter, lesser, and fires create Leucies.
So now Im learning that there are normals that create Leucies too??
Please correct me if Im wrong about that.
This is one of the snakes that is het Leucy but isn't any morph I don't think.
http://www.faunaclassifieds.com/foru...d.php?t=128666
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|