Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 676

0 members and 676 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,107
Posts: 2,572,120
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Page 1 of 3 123 LastLast
Results 1 to 10 of 24
  1. #1
    BPnet Veteran DSGB's Avatar
    Join Date
    08-12-2007
    Location
    ATL
    Posts
    1,260
    Thanks
    172
    Thanked 55 Times in 47 Posts
    Images: 5

    Exclamation My chondro suddenly refused f/t mouse

    Well my new chondro ate for me three times, all were f/t mice. I offered him/her one the twice the past week and he/she had no feeding response what so ever. One side of his/her tank is at 85 and the other is 75-78. I spray his/her tank once or twice a day and let it dry out at night. I offered him/her some different size perches, he/she went with the Y shaped branch that was a bit thicker, about a 1/2 inch, than what i had at first, about a 1/4 inch, and the one that he/she came with which was about 3 inches around. He/she is in the original tank i got with him/her the only difference is different perches and a fake plant or two. The first three feedings went great he/she took them right away. He/she has been less active at night also, except last night i woke up at 3 am to check on him/her and he/she was off its perch coiled up on the ground. Should i try a live mouse?

  2. #2
    BPnet Veteran DavidG's Avatar
    Join Date
    11-16-2008
    Location
    Alabama
    Posts
    644
    Thanks
    0
    Thanked 135 Times in 118 Posts

    Re: My chondro suddenly refused f/t mouse

    No need to try a live mouse. Green trees have much slower metabolisms than the more commonly kept snakes. feeding every 2 weeks should keep feeding responce like you're used to and still ne healthy for the animal.

  3. The Following User Says Thank You to DavidG For This Useful Post:

    DSGB (03-25-2009)

  4. #3
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: My chondro suddenly refused f/t mouse

    How old is your animal? That you are refering to it as he/she makes me think it is still quite young (i.e too young to sex) and because of that I would not advocate every 2 weeks if that is the case. More like every week. I only recently took my 5 y.o. female to every 14 days. Before that she was on a 7 day cycle.

    What time of day are you feeding? Are you warming the F/T. How are you heating? Are you heating at night? Have you tried tail tapping?
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  5. #4
    BPnet Veteran Wh00h0069's Avatar
    Join Date
    12-30-2007
    Location
    Middletown, OH
    Posts
    4,349
    Thanks
    915
    Thanked 832 Times in 736 Posts
    Images: 8

    Re: My chondro suddenly refused f/t mouse

    Quote Originally Posted by asplundii View Post
    Have you tried tail tapping?
    What is tail tapping?
    Eddie Strong, Jr.

  6. #5
    BPnet Veteran DSGB's Avatar
    Join Date
    08-12-2007
    Location
    ATL
    Posts
    1,260
    Thanks
    172
    Thanked 55 Times in 47 Posts
    Images: 5

    Re: My chondro suddenly refused f/t mouse

    Quote Originally Posted by asplundii View Post
    How old is your animal? That you are refering to it as he/she makes me think it is still quite young (i.e too young to sex) and because of that I would not advocate every 2 weeks if that is the case. More like every week. I only recently took my 5 y.o. female to every 14 days. Before that she was on a 7 day cycle.

    What time of day are you feeding? Are you warming the F/T. How are you heating? Are you heating at night? Have you tried tail tapping?
    No clue who old the animal is... I just don't know how to sex a snake so I'm not about to learn with my chondro, i offer at night with a small flashlight to not disturb him. I don't use any heat at night, my room stays 69-73 at night. He/she is one a 12 hour light cycle as well. Never heard of tail tapping, please explain.

  7. #6
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: My chondro suddenly refused f/t mouse

    Quote Originally Posted by Wh00h0069 View Post
    What is tail tapping?
    Chondros caudal lure. Sometimes, if you gently tap/bump the tip of their tail with the food item, it will elicit an instinctual feed response.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  8. #7
    BPnet Veteran Wh00h0069's Avatar
    Join Date
    12-30-2007
    Location
    Middletown, OH
    Posts
    4,349
    Thanks
    915
    Thanked 832 Times in 736 Posts
    Images: 8

    Re: My chondro suddenly refused f/t mouse

    Quote Originally Posted by asplundii View Post
    Chondros caudal lure. Sometimes, if you gently tap/bump the tip of their tail with the food item, it will elicit an instinctual feed response.
    Oh, great info. I will try that next time mine refuses a meal. Thanks.
    Eddie Strong, Jr.

  9. #8
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: My chondro suddenly refused f/t mouse

    DSGB,

    Okay, I can understand not wanting to learn sexing on a chondro. About how much does your animal weigh? I just want to get a feel if we are dealing with an animal that is a couple years old or something bit older.

    Also, forgot to ask, do you know locality?

    It seems unlikely but the flashlight might irk the animal enough to keep it from feeding. Might be worth looking into... If you can get a hold of one consider using a CF blacklight in a lamp in the same room. Should give you just enough light to see by and not disturb the snake too much. If you can not find a CF black light I might be able to hook you up with one if you can swing by Tech...

    Maybe I missed it but did you say if you heat the F/T once it was thawed? These guys will really key in on heat (note, do not try feeding after taking a hot shower, that is asking for trouble.)
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. The Following User Says Thank You to asplundii For This Useful Post:

    DSGB (03-25-2009)

  11. #9
    BPnet Veteran DavidG's Avatar
    Join Date
    11-16-2008
    Location
    Alabama
    Posts
    644
    Thanks
    0
    Thanked 135 Times in 118 Posts

    Re: My chondro suddenly refused f/t mouse

    If you had a very difficult feeder I would recommend every 7 days to get responce up. I do not think feeding every 2 weeks would cause an issue. The snake should still grow and have enough nutrition to perch all day and roam at night. With that said, I do not see a problem with feeding an adult every 7 days as long as the animal is acting normally and not obese.

    Green trees will dangle the lower part of their tail to attract food in the wild. Notice, it's a different color. Typically black, my PNG is blue. Try a day time feeding. I get off work around 5 and go home and feed without any issue. Offering multiple meats together will stress the snake. I strongly recommend at least 3 day break before your next attempt. Moving the mouse across the cage might help create a responce.

    as you can see, asp and myself have different methods. I wouldn't say either one is wrong, so many people do it so many different ways and a lot of them seem to work out fine. Hit up moreliaviridis.yuku.com and you'll find a ton of information a long with people more than willing to help.


    Edit to post on asp, who was typing while I was.

    It's a biak type.
    Cheapest light you can get that he can not see (debatable) is a standard red light for heating.

  12. The Following 3 Users Say Thank You to DavidG For This Useful Post:

    DSGB (03-25-2009),Michelle.C (03-25-2009),Wh00h0069 (03-25-2009)

  13. #10
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: My chondro suddenly refused f/t mouse

    Quote Originally Posted by Wh00h0069 View Post
    Oh, great info. I will try that next time mine refuses a meal. Thanks.

    No worries.

    I recommend you also check out Greg Maxwell's site (so long as you are not on a Mac...) for so good quick and dirty info and if you like what you read there then get his book.

    Cheers
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  14. The Following User Says Thank You to asplundii For This Useful Post:

    Wh00h0069 (03-25-2009)

Page 1 of 3 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1