» Site Navigation
1 members and 1,328 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,917
Threads: 249,118
Posts: 2,572,203
Top Poster: JLC (31,651)
Welcome to our newest member, Necbov
|
-
BAD news Georgia... :( ASF's BANNED
Sorry to inform you but LIVE African Soft Furred Rats have been banned in the state of Georgia.
As many of you know Charles Cardell and myself will have a table at the Repticon show outside of Atlanta this upcoming weekend. We were planning on having over 350 live ASF's to choose from, but yesterday I got the following email:
Dear Mr. Cavanaugh,
I noticed that you were bringing ASF rats to Repticon in Atlanta this coming weekend. African Soft Furred Rats cannot be possessed or imported into Georgia without a license. Please do not bring any live ASF to Georgia.
Please let me know if you have any questions.
Sincerely,
Todd N. Nims
Wildlife Biologist - Special Permit Unit
Georgia Wildlife Resources Division
2065 US Hwy 278 SE
Social Circle, GA 30025
We were hoping that this email just meant that you have to have a dealers license to sell them (Charles has a dealers license)... But after a long phone conversation with Todd Nims, we now know for a fact that it is illegal to have live ASF's in the state of Georgia period... as pets, or as feeders. He said African Soft Furred rats are a species they are just now cracking down on. I am sorry folks.
We still plan to attend the show, but will only have frozen available as the laws dictate. Todd Nims says selling / possessing frozen ASF's is fine. I know this is not the for sale section, so please see our post in the for sale section later today for updated frozen pricing.
Feel free to PM me with any questions you have that you don't want to ask on a public thread.
Regretfully,
Mike Cavanaugh
Mikey Cavanaugh
(904) 318-3333
-
-
BPnet Veteran
Re: BAD news Georgia... :( ASF's BANNED
Do they have a reason for the ban?
-
-
Re: BAD news Georgia... :( ASF's BANNED
Did they mention why it is banned? I mean, I understand if they want to ban imports from Africa or something... but I don't see a reason why captive born and bred rats would be a problem...
----------------------------------
BP owner since Oct 2008, so yeah, I'm no expert.
0.1.0 pastel bp
1.0.0 spider bp
0.1.0 albino bp
1.0.0 bumblebee bp
1.0.0 yellowbelly bp
0.0.1 normal bp
1.0.0 normal western hognose
Life should NOT be a journey to the grave with the intention of arriving safely in an attractive and well preserved body, but rather to skid in sideways, chocolate in one hand, body thoroughly used up, totally worn out and screaming "WOO HOO what a ride!"
-
-
Re: BAD news Georgia... :( ASF's BANNED
That's a Bummer man!
But I have heard about this! Them ASF's are crazy! You see, they are worried a pair will escape from someone, breed, and create a small army which will take over the state of Georgia... ...tragic.
____JOSHUA____
___  ___
ROCK CHALK JAYHAWK GO KU!!
Kansas City Chiefs
-
-
Re: BAD news Georgia... :( ASF's BANNED
-
-
BPnet Veteran
Re: BAD news Georgia... :( ASF's BANNED
 Originally Posted by aaronp
when did this happen!?
1982
-
-
Registered User
Re: BAD news Georgia... :( ASF's BANNED
just perfect.
-
-
BPnet Veteran
Re: BAD news Georgia... :( ASF's BANNED
 Originally Posted by Clear
Do they have a reason for the ban?
probably injurious wildlife! Who knows.
-
-
Re: BAD news Georgia... :( ASF's BANNED
were asf's banned specifically, or is it more generic: i.e. banning all non-native rodentia(with possible exclusions for guinea pigs etc)
-
-
Re: BAD news Georgia... :( ASF's BANNED
GA has some really silly laws on animals. A few years back my sister-in-law was trying to find a home for an unwanted sugar glider so I was looking into care and learned they were not legal here. I called a few places to see if there were any exceptions to this and asked why exactly they were not legal to keep. I was told (and this is where it gets funny) that sugar gliders were illegal to keep because there was a law stating no marsupials could be kept and that that law originated during the Depression to keep people from raising opposum as a food source... I guess the "no native animals" law was not enough to stop people from eating opposum so they had to add the "no marsupials" law as well. How stupid is that?
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|