Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 2,901

1 members and 2,900 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

» Stats

Members: 75,103
Threads: 248,542
Posts: 2,568,767
Top Poster: JLC (31,651)
Welcome to our newest member, Michaelmcalvey
Page 2 of 5 FirstFirst 12345 LastLast
Results 11 to 20 of 43
  1. #11
    BPnet Veteran Custom Exotics's Avatar
    Join Date
    12-28-2007
    Location
    United States
    Posts
    1,025
    Thanks
    20
    Thanked 105 Times in 85 Posts

    Re: Some Woma's we produced

    Quote Originally Posted by The Cleaner View Post
    To date Kevin released two hidden gene woma animals in the US so if someone didn't buy an animal from me (which I sold two '09 babies this season) or Kevin...they don't have one. The other animal he sold is a female and she may be breeding size this season.

    A normal woma has spider color and the typical woma pattern. Here is what a hidden gene woma looks like:

    2009 animal


    Adult male
    Wow, those Womas are crazy! Definately a different look there for sure, whether that is because the presence of the hidden gene or not, I don't know, but you can just look at those and tell something is going on. Very nice!
    Custom reptile and amphibian enclosures! As well as other custom wood working.

  2. #12
    Banned Simpson Balls's Avatar
    Join Date
    05-03-2009
    Location
    Ontario, Canada
    Posts
    1,065
    Thanks
    18
    Thanked 136 Times in 133 Posts
    Images: 9

    Re: Some Woma's we produced

    Give them all to me! I have been looking for a Woma for a long time!

    Daniel

  3. #13
    BPnet Lifer muddoc's Avatar
    Join Date
    03-23-2006
    Location
    Louisiana
    Posts
    5,340
    Thanks
    1,202
    Thanked 1,606 Times in 618 Posts
    Images: 49

    Re: Some Woma's we produced

    Quote Originally Posted by The Cleaner View Post
    To date Kevin released two hidden gene woma animals in the US so if someone didn't buy an animal from me (which I sold two '09 babies this season) or Kevin...they don't have one. The other animal he sold is a female and she may be breeding size this season.

    A normal woma has spider color and the typical woma pattern. Here is what a hidden gene woma looks like:
    Very intersting Matt. Thanks for the pics.
    Tim Bailey
    (A.K.A. MBM or Art Pimp)
    www.baileyreptiles.com
    The Blog

  4. #14
    Registered User rjs73's Avatar
    Join Date
    01-05-2009
    Location
    Oak Lawn,IL
    Posts
    195
    Thanks
    2
    Thanked 45 Times in 31 Posts
    Images: 5

    Re: Some Woma's we produced

    Thanks for the info and pics Matt. But if Kevin has only sold two hidden gene woma's why was he selling some, for example to Sean Bradley, as possible hidden gene carriers?
    Your hidden gene woma's are alot different looking than normal woma's. So there should be no guessing by the look of them as they are obviously different in appearance.
    Rick

  5. #15
    Registered User
    Join Date
    07-27-2008
    Posts
    34
    Thanks
    15
    Thanked 11 Times in 11 Posts
    Images: 8

    Re: Some Woma's we produced

    so, i have to ask. is the granite look in your line of womas common to the hidden gene? it is a little bit of a shame that so many of us have possible hidden gene womas if there is such a distinct appearance difference.
    i have one of the possible hidden gene womas getting ready to ovulate from a lesser. and it has nothing that resembles the granite influence.

    congrats on the incredible snakes you have been producing?
    howard

  6. #16
    BPnet Veteran Wh00h0069's Avatar
    Join Date
    12-30-2007
    Location
    Middletown, OH
    Posts
    4,349
    Thanks
    915
    Thanked 832 Times in 736 Posts
    Images: 8

    Re: Some Woma's we produced

    Quote Originally Posted by hross View Post
    so, i have to ask. is the granite look in your line of womas common to the hidden gene? it is a little bit of a shame that so many of us have possible hidden gene womas if there is such a distinct appearance difference.
    i have one of the possible hidden gene womas getting ready to ovulate from a lesser. and it has nothing that resembles the granite influence.

    congrats on the incredible snakes you have been producing?
    howard
    I'm sorry but that does not make sense. Either the woma is a gene carrier or it is not. If it is from the gene carrier line from N.E.R.D., then it is a gene carrier, if not then it is not.
    Eddie Strong, Jr.

  7. #17
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Some Woma's we produced

    Quote Originally Posted by Wh00h0069 View Post
    I'm sorry but that does not make sense. Either the woma is a gene carrier or it is not. If it is from the gene carrier line from N.E.R.D., then it is a gene carrier, if not then it is not.
    Not if they are two different animals.

    I guess my explanation above was not clear so let me try again.

    There are 2 different morphs that look similar but, as far as is know, are not related.

    One of these (call it Type I) had a founder animal that carried the "hidden gene" (which is separate and distinct from the Type I gene and itself passes in a co-dom manner.)

    The other (call it Type II) has no affiliation with a hidden gene.

    When these 2 different animals were brought in they were thought to be the same and Kevin called them both "Woma Tiger". After breeding them out a bit it became obvious that they were not the same.

    Now, the nature of the "hidden gene" was not really known back then. My guess (and it is just a guess) is that, to keep things straight Kevin just started calling the ALL the odd looking ones "hidden gene" Woma to differentiate them from the typical Woma because he still though the 2 original animals were related and that the "hidden gene" caused the tweak in the appearance. It is only with his further work that he has concluded that Type I and Type II are not related but in that time the epithet of "Hidden Gene Woma" had become part of the vernacular.

    So, when you think of "Hidden Gene Woma" it needs to be as a name alone and not as some guarantee of genetics. If I had to guess I would say that Kevin is probably trying to come up with a better name so that the distinction between these two distinct morphs will be more clear. But the hurdle of getting the new name to displace the old name could be a real pain.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  8. The Following User Says Thank You to asplundii For This Useful Post:

    hross (08-07-2009)

  9. #18
    Registered User
    Join Date
    07-27-2008
    Posts
    34
    Thanks
    15
    Thanked 11 Times in 11 Posts
    Images: 8

    Re: Some Woma's we produced

    i am sorry if the fact that two possible distinct morphs called the same thing by the same breeder and marketed as such with possible hidden genes is a little confusing to me.

    matt has come out and said the "hidden gene" is a complete different look than the spider like womas that were marketed as potential hidden gene carriers. and his photos look nothing like the spider like womas.

  10. #19
    Registered User rjs73's Avatar
    Join Date
    01-05-2009
    Location
    Oak Lawn,IL
    Posts
    195
    Thanks
    2
    Thanked 45 Times in 31 Posts
    Images: 5

    Re: Some Woma's we produced

    matt has come out and said the "hidden gene" is a complete different look than the spider like womas that were marketed as potential hidden gene carriers. And his photos look nothing like the spider like womas.
    I agree. I understand that they are two completely different animals, but they have two different looks to them. So if the one's that Matt posted are the hidden gene woma's, then why was the one I purchased from Sean Bradley, sold to him by Kevin as a possible hidden gene carrier when it and his offspring look nothing like what Matt pictured?

    Now are the one's Matt pictured are they the granite woma's, which may be making them look different, or are they just plain woma's.
    If they are just woma's without the granite influence then there should be no confusion between the hidden gene woma's (Type 1) and the regular woma's(type 2).

    I'm not trying to piss anyone off here. I'm just trying to figure out how you can say it is a possible hidden gene carrier when they look so much different from each other.

    Either way I love the head patterns on the one I produced and will end up keeping them anyway.
    Rick

  11. #20
    in evinco persecutus dr del's Avatar
    Join Date
    04-20-2006
    Location
    Edinburgh, Scotland
    Posts
    24,527
    Thanks
    9,263
    Thanked 6,788 Times in 4,306 Posts
    Images: 93

    Re: Some Woma's we produced

    Hi,

    Well the first pic is labled HGWYBF so I assume it is also a yellow belly? That would knock it up a notch.


    dr del
    Derek

    7 adult Royals (2.5), 1.0 COS Pastel, 1.0 Enchi, 1.1 Lesser platty Royal python, 1.1 Black pastel Royal python, 0.1 Blue eyed leucistic ( Super lesser), 0.1 Piebald Royal python, 1.0 Sinaloan milk snake 1.0 crested gecko and 1 bad case of ETS. no wife, no surprise.

Page 2 of 5 FirstFirst 12345 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1