» Site Navigation
3 members and 3,455 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,095
Threads: 248,538
Posts: 2,568,730
Top Poster: JLC (31,651)
Welcome to our newest member, Daisyg
|
-
Patternless Traits
not necessarily about BP’s specifically but thought this might be a generalized question but if a patternless male mates with a patternless female, both from the same specific locality, would the resulting clutch be comprised of all patternless babies? likewise, if a patternless male mates with a patterned female, again, of the same locality, would that result in a mixed clutch or…?
het for nothing but groovy
-
-
It really depends on the underlying genetics of what is causing it. Generally speaking, more often than not, yes or at least close to it. If incomplete dominants are involved, it's very possible to have patternless caused by that, each parent has one copy of the gene causing it, but then 25% of the offspring would not get at least one copy and then be wild type. If two completely different morphs are involved, each offspring could end up het for both but have no visual effect.
In BP's specifically, most the morphs off the top of my head that take away all the pattern are the super form of an incomplete dominant that require two copies to appear patternless, so all offspring would be patternless so long as it's the same morph. But If you bred an Ivory to a blue eyed lucy, all the offspring would usually have pattern.
7.22 BP 1.4 corn 1.1 SD retic 0.1 hognose
-
The Following 2 Users Say Thank You to nikkubus For This Useful Post:
Bogertophis (06-07-2022),YungRasputin (06-07-2022)
-
Re: Patternless Traits
Originally Posted by nikkubus
It really depends on the underlying genetics of what is causing it. Generally speaking, more often than not, yes or at least close to it. If incomplete dominants are involved, it's very possible to have patternless caused by that, each parent has one copy of the gene causing it, but then 25% of the offspring would not get at least one copy and then be wild type. If two completely different morphs are involved, each offspring could end up het for both but have no visual effect.
In BP's specifically, most the morphs off the top of my head that take away all the pattern are the super form of an incomplete dominant that require two copies to appear patternless, so all offspring would be patternless so long as it's the same morph. But If you bred an Ivory to a blue eyed lucy, all the offspring would usually have pattern.
well to give more information because idk how much is true for all snakes and how of this might be species specific but the information i have rn is: patternless coloration in scrub pythons is a naturally occurring morph that doesn’t have any relation to hobby morphs insomuch as the phenomena is not the result of selective breeding by hobbyists - i have a patternless Southern/Merauke male and was wondering what would take place if i bred them with patterned and patternless Southern/Merauke females
het for nothing but groovy
-
-
Hmm. I wonder if anyone with a lot of scrub experience knows if it's a simple recessive. That would be my guess, in which case all OS should be patternless. I know there are a few guys on here that keep scrubs and might have an answer.
7.22 BP 1.4 corn 1.1 SD retic 0.1 hognose
-
The Following 2 Users Say Thank You to nikkubus For This Useful Post:
Bogertophis (06-08-2022),Homebody (06-08-2022)
-
Re: Patternless Traits
Originally Posted by nikkubus
scrub experience knows if it's a simple recessive.
To the best of my knowledge it is recessive. That said, there are a handful of different scrub species so it may not hold true for all of them. Also, there are some animals that are not so much patternless as their pattern has simply faded away as they aged
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
Bogertophis (06-08-2022),nikkubus (06-08-2022)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|