Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,102

1 members and 3,101 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

None

» Stats

Members: 75,111
Threads: 248,550
Posts: 2,568,821
Top Poster: JLC (31,651)
Welcome to our newest member, GhostyBoy29
Results 1 to 3 of 3
  1. #1
    Registered User
    Join Date
    11-11-2021
    Posts
    3
    Thanks
    2
    Thanked 0 Times in 0 Posts

    Breeding Sugar to Sugar?

    Has anyone ever done this pairing? I can't seem to find info on it. Some people have sugar/calico listed as incomplete dominant and others have it listed as dominant. What I want to know is if it has a lethal super form like spider x spider or is it okay?

    Thank you for any help.

  2. #2
    BPnet Veteran nikkubus's Avatar
    Join Date
    12-20-2018
    Posts
    1,370
    Thanks
    2,509
    Thanked 1,847 Times in 972 Posts
    Not sure on this one, but I'm betting it's dominant or very subtle difference between super form considering there is only a single one ever offered for sale on morph market that is a "super". Could be lethal homozygous though I suppose, I just haven't heard of anyone suggesting that. I don't think a lot of the breeders I follow work with Sugar or Calico though.
    7.22 BP 1.4 corn 1.1 SD retic 0.1 hognose

  3. #3
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    There were a few Calico x Calico done in the early days of the morph and no visual superform was ever witnessed. There were no really good reports around whether or not the clutches were smaller in size or if there were higher numbers of dud eggs so the assumption at this time is that it is a simple dominant mutation but it is certainly open to further investigation
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Alicia (11-16-2021),nikkubus (11-15-2021)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1