» Site Navigation
2 members and 3,268 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,095
Threads: 248,538
Posts: 2,568,726
Top Poster: JLC (31,651)
Welcome to our newest member, Daisyg
|
-
Registered User
-
-
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
BRD (08-04-2021),nikkubus (08-05-2021)
-
Registered User
Re: Need help verify Morph
Originally Posted by asplundii
Your animal is a Fire
So the dark black dorsal is common in the Fire gene? I always thought the Fire gene was lighter in a sense. Thank you for your input!
-
-
Can you post pics of parents? Looks like a Trick.
Edit: So does the left one in top pic too.
Last edited by nikkubus; 08-05-2021 at 02:34 AM.
7.22 BP 1.4 corn 1.1 SD retic 0.1 hognose
-
The Following User Says Thank You to nikkubus For This Useful Post:
-
Registered User
Re: Need help verify Morph
Originally Posted by nikkubus
Can you post pics of parents? Looks like a Trick.
Edit: So does the left one in top pic too.
Here is Dad...Enchi Fire het TSK Axanthic
Here is mom... Pastave
-
-
Re: Need help verify Morph
My guess is the hatchling in question is also het for TSK Axanthic and you are seeing the influence of the gene.
-
The Following 2 Users Say Thank You to rlditmars For This Useful Post:
BRD (08-06-2021),nikkubus (08-05-2021)
-
Neither parent looks like a Trick, though dad does have some pretty pixelated pattern where enchi didn't wipe it out, so I think rlditmars might be right.
7.22 BP 1.4 corn 1.1 SD retic 0.1 hognose
-
The Following User Says Thank You to nikkubus For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|