Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,096

0 members and 3,096 guests
No Members online
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

zacharynay (18)

» Stats

Members: 75,114
Threads: 248,554
Posts: 2,568,844
Top Poster: JLC (31,651)
Welcome to our newest member, kindred_of_rot
Page 3 of 3 FirstFirst 123
Results 21 to 22 of 22
  1. #21
    BPnet Veteran Snagrio's Avatar
    Join Date
    08-11-2020
    Posts
    1,011
    Thanks
    187
    Thanked 1,313 Times in 572 Posts

    Re: My Ball Python tested positive for Nidovirus

    Quote Originally Posted by Malum Argenteum View Post
    I'm glad this thread got bumped, since that linked discussion is fantastic. Here's a link to the podcast version:

    https://soundcloud.com/theherpetocul...dr-porcher-dvm

    Good to hear that RAL is recommended by Dr. Porcher. I've been using their services and this makes me feel even more secure in doing so.
    Makes me feel better too. I've done a full test panel for all 3 of my snakes. Can't be too careful.

  2. The Following 2 Users Say Thank You to Snagrio For This Useful Post:

    Bogertophis (09-01-2022),Malum Argenteum (09-01-2022)

  3. #22
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: My Ball Python tested positive for Nidovirus

    Quote Originally Posted by Malum Argenteum View Post
    I'm glad this thread got bumped, since that linked discussion is fantastic.
    There is a second discussion from 13Dec2021 as well, episode #102
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Bogertophis (09-02-2022),Malum Argenteum (09-03-2022)

Page 3 of 3 FirstFirst 123

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1