Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 766

1 members and 765 guests
Most users ever online was 9,191, 03-09-2025 at 12:17 PM.

» Today's Birthdays

None

» Stats

Members: 75,887
Threads: 249,087
Posts: 2,572,044
Top Poster: JLC (31,651)
Welcome to our newest member, Saexs
Results 1 to 2 of 2

Threaded View

  1. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    The entire definition of a recessive gene revolves around the fact that there is no phenotypic expression when only one copy of the mutation is present. If the heterozygous state results in any change in phenotype then the gene is either dominant or incomplete-dominant in its expression
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 4 Users Say Thank You to asplundii For This Useful Post:

    ballpythonluvr (04-08-2021),Bogertophis (04-08-2021),jmcrook (04-08-2021),Toad37 (04-08-2021)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1