» Site Navigation
1 members and 3,143 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,100
Threads: 248,542
Posts: 2,568,763
Top Poster: JLC (31,651)
|
-
Re: Future pairings, thoughts and discussion. (everyone)
I would keep the single gene male clown because he will be able to breed in probably less than a year. There have been anecdotal reports of male balls breeding at early ages and surprisingly lower weights. Some that may not necessarily being seen to be producing sperm plugs. Most have gone on to successfully sire clutches. Any clown is a worthy keeper to me. Consider putting him( once he has a reasonable weight and size) to all your intended females. I’m actively putting my 10 month old red stripe yellow belly 66% Het clown male to a unproven first time coral glow female possible Het clown. There have been a couple of locks over the past weeks.
Last edited by Albert Clark; 02-11-2022 at 12:10 AM.
Reason: Add info.
Stay in peace and not pieces.
-
The Following 2 Users Say Thank You to Albert Clark For This Useful Post:
Daniel_Effler (02-11-2022),nikkubus (02-11-2022)
-
Re: Future pairings, thoughts and discussion. (everyone)
Originally Posted by Albert Clark
I would keep the single gene male clown because he will be able to breed in probably less than a year. There have been anecdotal reports of male balls breeding at early ages and surprisingly lower weights. Some that may not necessarily being seen to be producing sperm plugs. Most have gone on to successfully sire clutches. Any clown is a worthy keeper to me. Consider putting him( once he has a reasonable weight and size) to all your intended females. I’m actively putting my 10 month old red stripe yellow belly 66% Het clown male to a unproven first time coral glow female possible Het clown. There have been a couple of locks over the past weeks.
Awesome! Good luck with that pairing. I bet you will make some awesome babies there. I love the look of a banana clown.
Sent from my SM-S426DL using Tapatalk
-
The Following User Says Thank You to Daniel_Effler For This Useful Post:
Albert Clark (02-11-2022)
-
Re: Future pairings, thoughts and discussion. (everyone)
Originally Posted by Daniel_Effler
Awesome! Good luck with that pairing. I bet you will make some awesome babies there. I love the look of a banana clown.
Sent from my SM-S426DL using Tapatalk
Thank you D! I’m excited about the possibilities. Just wish she was 66% or 100% het. Only one way to find out if she proves out as a sole possible. Lol. Good luck with your projects.
Stay in peace and not pieces.
-
The Following User Says Thank You to Albert Clark For This Useful Post:
Daniel_Effler (03-13-2022)
-
Re: Future pairings, thoughts and discussion. (everyone)
This is my current plan with what I have.
You will see that I have two almost identical males here and that's because one got out and was nowhere to be found for 3-4 months. I gave up on him and had gotten a replacement. After I get the replacement he showed back up in the bathroom floor one day.
This is my working plan.
1) With the first trio I am looking to create albino pieds, cherry bombs, and Panda pieds.
2) This trio is just a simple clown trio looking to make if I hit the best odds a leopard clown and a firefly clown.
3) this is the duplicate banana I bought but I do know this one is a female maker so I'm using it with what I feel is the stronger contenders to be paired with the two bananas. Looking to make some bamboo Mojave BEL, and some just stunning banana combinations hopefully.
4) The next trio I am looking to create 8 Ball and BEL I do not know if this is a male or female maker.
5) really not sure if I'm going to move forward with these pairings or not. I got this male without Really a plan. I feel that what I am pairing him with could make some very nice snakes but of course they will all be just het candy. I may move one of these up to a different category later on and see about getting another candy or het candy to work with. I am personally not real big on combining the candy and toffee genes with albino as I think it can get confusing so I probably will not breed him to my albino female.
Hoping to get 1-2 breed this year. The albino female is big enough and my BEL girl is right on the edge.
Sent from my SM-S426DL using Tapatalk
Last edited by Daniel_Effler; 03-13-2022 at 09:51 PM.
-
The Following 3 Users Say Thank You to Daniel_Effler For This Useful Post:
Albert Clark (03-15-2022),Armiyana (03-14-2022),nikkubus (03-14-2022)
-
This seems like a really neat project!
I guess my only 2 cents to the matter is:
The female pastel fire Enchi in group 5 that you're unsure on...might be a good one to toss to one of the banana Mojave boys. Personal bias because of of my favs is my Coral Glow Mojave fire gal. (Opal in my gallery)
Good luck!
-
The Following 2 Users Say Thank You to Armiyana For This Useful Post:
Daniel_Effler (03-14-2022),nikkubus (03-14-2022)
-
I think those are some pretty solid choices. Hope it goes well for you!
7.22 BP 1.4 corn 1.1 SD retic 0.1 hognose
-
The Following 2 Users Say Thank You to nikkubus For This Useful Post:
Albert Clark (03-15-2022),Daniel_Effler (03-14-2022)
-
Re: Future pairings, thoughts and discussion. (everyone)
Originally Posted by Daniel_Effler
Awesome! Good luck with that pairing. I bet you will make some awesome babies there. I love the look of a banana clown.
Sent from my SM-S426DL using Tapatalk
Hey D, don’t sleep on the young males you have. Also, their ability to sire clutches at lower weights and younger ages.
Stay in peace and not pieces.
-
The Following User Says Thank You to Albert Clark For This Useful Post:
Daniel_Effler (03-15-2022)
-
Re: Future pairings, thoughts and discussion. (everyone)
Originally Posted by Daniel_Effler
That's why I got the black pastel banana. I actually like the adult version better than the hatchling. It's one of the few bananas I've seen so far I like the adult better in. The purplish grey background with yellow spots is what I am hoping to get.
But nothing can beat a banana hatchling at impulse sales lol. Sadly most do know know that they change so much as they grow.
Are the albinos allylic with lavender albinos? The double hey may produce a visual. I know the candy is compatible with albino so I would think lavender albino would be also.
Sent from my SM-S767VL using Tapatalk
This is a great thread highlighting differences in albino and lavender albino. Allellic or not Allellic? Questions answered.
- Thread Tools
- Search Thread
- Display
- 06-09-2020, 03:01 PM
Kingdomall
Registered UserJoin Date06-07-2020Posts41Thanks0Thanked 14 Times in 8 Posts
Albino and Lavender
Hello there,
I'm sure this question has been asked many, many times (yet I couldn't find an answer). But, is there a genetic difference between albino and lavender albino?
Say I breed a lav albino and an albino. will all babies be normals but with het albino/lav albino, or will they combine?
If it's a genetic difference and the genes don't mix like that, then I'm truly intrigued as to how these two genes separated like this.
Thanks.
Last edited by Kingdomall; 06-09-2020 at 03:05 PM.
Thanks Blog this Post
- 06-09-2020, 03:07 PM
Stewart_Reptiles
Telling it like it is! Join Date09-28-2006Posts24,840Thanks6,116Thanked 20,797 Times in 9,579 PostsBlog Entries1Images: 6
Re: Albino and Lavender
Originally Posted by Kingdomall
Hello there,
I'm sure this question has been asked many, many times (yet I couldn't find an answer). But, is there a genetic difference between albino and lavender albino?
Say I breed a lav albino and an albino. will all babies be normals but with het albino/lav albino, or will they combine?
If it's a genetic difference and the genes don't mix like that, then I'm truly intrigued as to how these two genes separated like this.
Thanks.
They are not the same and are not compatible so if you were to breed Lavender to Albino you would get some Double Hets, by breeding those double hets you would have 1/16 chance to produce a Double Recessive however will it be different or easily idenfiable it not likely.
Thanks Blog this Post
- The Following User Says Thank You to Stewart_Reptiles For This Useful Post:
- 06-09-2020, 03:38 PM
PartySnake13
Registered UserJoin Date07-03-2019Posts98Thanks145Thanked 27 Times in 19 Posts
Re: Albino and Lavender
Originally Posted by Kingdomall
Hello there,
I'm sure this question has been asked many, many times (yet I couldn't find an answer). But, is there a genetic difference between albino and lavender albino?
Say I breed a lav albino and an albino. will all babies be normals but with het albino/lav albino, or will they combine?
If it's a genetic difference and the genes don't mix like that, then I'm truly intrigued as to how these two genes separated like this.
Thanks.
There are numerous locations where a spontaneous mutation can occur, causing the disruption of one step in the melanin production process and resulting in an albino snake.
The albino and lavender albino genes are located on different alleles, therefore if bred together the offspring will still have one working melanin production gene at both alleles.
For example, Albino and Candy are located on the same allele, therefore breeding them together will produce an intermediate form of albinism known as a candino.
When breeding an Albino to a Lavender Albino each parent passes on one copy of their different albino gene and one normal gene for the opposing form of albino.
A lavender albino has 2 normal alleles for albino; an albino has 2 normal alleles for lavenderalbino.
Producing visual/ double homologous lavender albino albinos would likely be an waste of time/ resources, only resulting in an albino looking animal with a possible pattern influence from the lavender trait, as the albino gene's inability to produce blue pigment would likely dominate the lavender albino genes colors, and at the end of the day there are much more rewarding double het projects.
Last edited by PartySnake13; 06-09-2020 at 03:47 PM.
Thanks Blog this Post
- 06-09-2020, 07:31 PM
Kingdomall
Registered UserJoin Date06-07-2020Posts41Thanks0Thanked 14 Times in 8 Posts
Re: Albino and Lavender
thank you for your responses, I appreciate it greatly
Thanks Blog this Post
- The Following User Says Thank You to Kingdomall For This Useful Post:
- 06-10-2020, 09:10 AM
asplundii
BPnet Veteran Join Date10-17-2008Posts901Thanks101Thanked 703 Times in 374 Posts
Re: Albino and Lavender
Originally Posted by PartySnake13
The albino and lavender albino genes are located on different alleles, therefore if bred together the offspring will still have one working melanin production gene at both alleles.
For example, Albino and Candy are located on the same allele, therefore breeding them together will produce an intermediate form of albinism known as a candino.
As a point of clarification:
Alleles are different versions of the same gene. So Albino and Candy are alleles which is why they are compatible and make the heteroallelic Candino
Albino and Lav are two completely different, unrelated genes. Because of this, they are not alleles
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
Thanks Blog this Post
+ Reply to Thread
Your Message
Title:
[COLOR=#000000][FONT=Arial][TABLE="class: cke_editor, width: 673"]
[TR]
[TD="class: cke_top"] FontSize
Last edited by Albert Clark; 03-15-2022 at 03:13 PM.
Stay in peace and not pieces.
-
The Following User Says Thank You to Albert Clark For This Useful Post:
Daniel_Effler (03-15-2022)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|