Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 3,458

5 members and 3,453 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.

» Today's Birthdays

» Stats

Members: 75,096
Threads: 248,538
Posts: 2,568,731
Top Poster: JLC (31,651)
Welcome to our newest member, eamorris97
Results 1 to 9 of 9
  1. #1
    BPnet Lifer dakski's Avatar
    Join Date
    02-08-2014
    Location
    Connecticut
    Posts
    4,802
    Thanks
    8,109
    Thanked 9,691 Times in 3,863 Posts
    Images: 134

    I am trying Reptilinks.......

    I ordered some Reptilinks for Frank, the BTS.

    I've heard mixed things about snakes eating them successfully (especially larger snakes), mainly because they can break on constriction. I don't know if this is an old issue, or a common issue, but I've seen that a few places online.

    If you've tried them and have thoughts, please post (WrongPython - I know you've bought them and fed them).

    For what's worth, I did not order anything large enough or snake appropriate. I did order several links specifically suited for BTS.

    Order summary
    Quail, Rabbit, Fruits & Veggies × 1
    8-12 g (40 links)
    $34.99
    Mix in 1-dozen quail eggs directly into the links! × 1
    checked
    $4.80
    Insect & Rabbit + Fruits and Veggies × 1
    8-12 g (40 links)
    $34.99
    25/25/50 Omnivore blend + Insects for Bearded Dragons & Blue-tongued Skinks × 1
    8-12 g (40 links)
    $36.99
    Mix in 1-dozen quail eggs directly into the links! × 1
    checked
    $4.80

    I probably should have ordered more of the 25/25/50 links and/or some pure protein links, as they are custom ordered and made, but I'll see what Frank thinks before I go crazy. I can always mix in more protein, more fruit, etc. to make it a balanced meal for him.

    As you can see, they are not cheap, but they are very nutritious and I imagine he will love them.

    I was also fascinated to see that they have "scenting" products for picky eaters. I thought that was pretty cool.

    I will report back and let everyone know what I think of the product. Overall, very excited and frankly, wish they made an insect only link (small) for my LG's and Ferry the Chewie.

    https://reptilinks.com

    https://reptilinks.com/collections/scenting

  2. #2
    bcr229's Avatar
    Join Date
    03-18-2013
    Location
    Eastern WV Panhandle
    Posts
    9,503
    Thanks
    2,891
    Thanked 9,862 Times in 4,780 Posts
    Images: 34
    I've purchased them and used the rabbit for smaller snakes. My young/growing boas and retics boas took to them immediately, others don't. Ball pythons are unlikely to eat them.

    Mine would have been one of the reports of a link breaking. I offered a 50 gram link to a BRB, and the link is fairly long, almost like a hot dog. While the BRB was happy enough to eat it, if you've ever compared how they constrict their prey versus other constrictors, you can see that they give a much tighter twist and bend just behind their heads, which resulted in the links ripping right in half. The BRB's still ate the links but it was a fairly messy process. I gave the other 50 gram links to my BI's who were not as enthusiastic about "killing" their food and they were fine.
    Last edited by bcr229; 03-29-2021 at 08:01 AM.

  3. The Following 4 Users Say Thank You to bcr229 For This Useful Post:

    Bogertophis (03-29-2021),Caitlin (03-29-2021),dakski (03-29-2021),WrongPython (03-29-2021)

  4. #3
    BPnet Veteran Hugsplox's Avatar
    Join Date
    08-27-2020
    Location
    Georgia, U.S.
    Posts
    695
    Thanks
    1,695
    Thanked 1,130 Times in 534 Posts

    Re: I am trying Reptilinks.......

    Here's a great video that came out over the weekend from Emily at Snake Discovery. She's carrying Reptilinks in their new facility and the company sent them some stuff for their animals to try, so she goes through and shows the sizes, scenting stuff, and them feeding their animals. Might be interesting for you

    https://www.youtube.com/watch?v=e5n9C6b2Bog

    Also if any of you have little ones that are into reptiles, this is a fantastic family friendly channel to share with them.

  5. The Following 3 Users Say Thank You to Hugsplox For This Useful Post:

    Alien (04-16-2021),Bogertophis (03-29-2021),Caitlin (03-29-2021)

  6. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    I use Links to some extent or other for most of the species in my collection. I do not do it for the balls because most of them are not interested (I have four that will eat anything but the others only do rodents). The Dumeril also refuses to eat them. I have not tried them on the Calabar as they are imports and my primary goal with them is consistently feeding before they come out of quarantine, once they come out of Q I may try but their manner of feeding will likely mean links are not suitable.

    Species I feed:

    Oligodon purpurascens - microlinks; iguana, frog, quail, guinea fowl
    Rhamphiophis oxyrhynchus and R. rostratus - minilinks; iguana, frog, quail, guinea fowl
    Bredli - regular links, any size up to 50g; cycling between ones with fruit/veggie mixed in, egg mixed in, or roaches mixed in
    Blackhead - 100g links; cycling between ones with fruit/veggie mixed in, egg mixed in, or roaches mixed in
    Chondro - regular links, any size up to 25g; quail and guinea fowl
    alterna - minilinks; iguana, frog, quail, guinea fowl
    Hognose - microlinks; iguana, frog, quail, guinea fowl
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  7. The Following 4 Users Say Thank You to asplundii For This Useful Post:

    Bogertophis (03-29-2021),Caitlin (03-29-2021),dakski (03-29-2021),WrongPython (03-29-2021)

  8. #5
    BPnet Veteran WrongPython's Avatar
    Join Date
    06-08-2019
    Posts
    545
    Thanks
    1,559
    Thanked 1,813 Times in 492 Posts

    Re: I am trying Reptilinks.......

    Just got some day-old quail and 16-20g Mega-Blend links in from them. The links are Adelita-approved! She had a little trouble figuring out how to eat it, but she took it right off the tongs, no hesitation whatsoever. I warmed up her link with Kuzco's mouse for about a minute to scent it after it thawed, but I don't think that was necessary.

    If the rest of the crew likes them and all do well with them I'll probably be ordering more in the future. It's an easy way to get some more diverse proteins for my mid-sized crew in a size that's okay for them to eat.

    Sent from my SM-N960U using Tapatalk
    0.1 Sonoran Boa sigma​: "Adelita" ('19 Hypo het. leopard)
    1.0 Boa imperator longicauda: "Kuzco" ('19 het. anery)
    0.1 West Papuan Morelia spilota​: "Pandora" ('20)

  9. The Following 2 Users Say Thank You to WrongPython For This Useful Post:

    Bogertophis (03-29-2021),dakski (03-29-2021)

  10. #6
    BPnet Lifer dakski's Avatar
    Join Date
    02-08-2014
    Location
    Connecticut
    Posts
    4,802
    Thanks
    8,109
    Thanked 9,691 Times in 3,863 Posts
    Images: 134

    Re: I am trying Reptilinks.......

    Frank was quite happy with the reptilinks. I tried two today and added some extra veggies. He was very happy. However, he got full pretty quick. He ate all his veggies and 1 1/2 links.

    Last edited by dakski; 04-15-2021 at 10:35 PM.

  11. The Following 3 Users Say Thank You to dakski For This Useful Post:

    Bogertophis (04-15-2021),jmcrook (04-15-2021),WrongPython (04-16-2021)

  12. #7
    Bogertophis's Avatar
    Join Date
    04-28-2018
    Location
    USA
    Posts
    20,250
    Thanks
    28,168
    Thanked 19,830 Times in 11,847 Posts
    He's such a cutie. And I'm not surprised he likes them.
    Rudeness is the weak man's imitation of strength.
    Eric Hoffer (1902 - 1983)

  13. The Following User Says Thank You to Bogertophis For This Useful Post:

    dakski (04-15-2021)

  14. #8
    BPnet Lifer dakski's Avatar
    Join Date
    02-08-2014
    Location
    Connecticut
    Posts
    4,802
    Thanks
    8,109
    Thanked 9,691 Times in 3,863 Posts
    Images: 134

    Re: I am trying Reptilinks.......

    Quote Originally Posted by Bogertophis View Post
    He's such a cutie. And I'm not surprised he likes them.
    Me neither. However, I ordered the smallest packages and they are big given how much he eats. I got 3 packages! If he eats 1-3 links a week, there is no way I am going through them. I wanted to try different types and also make the shipping worthwhile, but I over did it.

    I will give some away and next time will order a few, or see if my local reptile store can split and order with me.

    He's also a little dull because he is going to shed soon. Still a looker. .
    Last edited by dakski; 04-15-2021 at 10:46 PM.

  15. The Following 3 Users Say Thank You to dakski For This Useful Post:

    Bogertophis (04-15-2021),Hugsplox (04-16-2021),WrongPython (04-16-2021)

  16. #9
    BPnet Veteran WrongPython's Avatar
    Join Date
    06-08-2019
    Posts
    545
    Thanks
    1,559
    Thanked 1,813 Times in 492 Posts

    Re: I am trying Reptilinks.......

    +1 vote for splitting Reptilinks orders with people.

    This is probably the biggest problem I have with Reptilinks. The minimum order requirement makes them somewhat unviable for those of use with small groups, ie. pet keepers. I get the impression that the company may be waiting to more pet stores to start distributing their product to really break in to the pet-keeper side of the market. Which....meh.

    How are you storing your links? If you keep them sealed and frozen, the unopened bags should be good for a year. Pairing the links with some fresh greens and veggies should help offset the loss of nutrients from aging.
    0.1 Sonoran Boa sigma​: "Adelita" ('19 Hypo het. leopard)
    1.0 Boa imperator longicauda: "Kuzco" ('19 het. anery)
    0.1 West Papuan Morelia spilota​: "Pandora" ('20)

  17. The Following User Says Thank You to WrongPython For This Useful Post:

    dakski (04-16-2021)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1