» Site Navigation
3 members and 3,556 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,095
Threads: 248,538
Posts: 2,568,724
Top Poster: JLC (31,651)
Welcome to our newest member, Daisyg
|
-
Bioactive Mold or Fungus?
I've had a bioactive enclosure for my two female cresties for about a year, moved them to another larger enclosure because they are nearing mature size, so the enclosure is just plants, isopods and springtails right now. A couple weeks ago I noticed little white balls in the hydroton, which I was hoping throwing more springtime in would help but it didnt, and for some reason this week it expldidn't,
Can anyone identify what this is so I can figure out the best animal safe way to get rid of it? I dont want to kill my isopods if I can help it.
Sent from my SM-G970U using Tapatalk
7.22 BP 1.4 corn 1.1 SD retic 0.1 hognose
-
-
The springtails should be eating the mold. Has your clean up crew population declined?
-
-
Re: Bioactive Mold or Fungus?
Originally Posted by Trinityblood
The springtails should be eating the mold. Has your clean up crew population declined?
Yeah, that's why I added more, thinking maybe they had declined, but it didn't seem to help, or maybe the mold grew faster than the addition could handle. Does it look like mold for sure? I can just dump a ton in there and see if that helps?
7.22 BP 1.4 corn 1.1 SD retic 0.1 hognose
-
-
Re: Bioactive Mold or Fungus?
Originally Posted by nikkubus
Yeah, that's why I added more, thinking maybe they had declined, but it didn't seem to help, or maybe the mold grew faster than the addition could handle. Does it look like mold for sure? I can just dump a ton in there and see if that helps?
I think it's mold. A population increase of springtails would help. Since you haven't put your cresties in yet you could also lower the terrariums humidity to help clear it up.
-
The Following User Says Thank You to Trinityblood For This Useful Post:
-
When you first set up a bioactive, it is going to go through a stage where it needs "mature" to balance out the nutrients versus the microfauna versus the clean-up crew. That is what you are seeing here. This is why most people that do bioactives will set them up months in advance
The fungus is not a hazard to your animals. In a while you will probably see small yellow or white mushrooms begin to appear. It will boom and bust for a while and then stabilize out
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 3 Users Say Thank You to asplundii For This Useful Post:
Bogertophis (02-05-2021),nikkubus (02-05-2021),Trinityblood (02-05-2021)
-
The weird thing is this isn't the new setup, this is the older one, and it was doing fine for a whole year and this started once I took the geckos out. Maybe not having them in there, I got a little wishy washy on misting and lost some of the springtails, idk, that's the only thing I can think of. Maybe the better thing to do would be to let it dry out pretty good and start completely over with the isopods and springtails vs try to get them to tackle all that?
7.22 BP 1.4 corn 1.1 SD retic 0.1 hognose
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|