» Site Navigation
4 members and 3,343 guests
Most users ever online was 6,337, 01-24-2020 at 04:30 AM.
» Today's Birthdays
» Stats
Members: 75,095
Threads: 248,538
Posts: 2,568,730
Top Poster: JLC (31,651)
Welcome to our newest member, Daisyg
|
-
Hidden Gene Woma?
There seems to be a lack of HGW photos, especially of combos, online. Does anyone see HGW in either of these two? Also, what would you guess they are? The darker of the two came from a pairing of a (lesser, fire) x (pastel, mojave, HGW). The more yellow looking one came from a different clutch (super lemon pastel, enchi) x (pastel, mojave, HGW). I recieved them in a trade so they will be staying with me, so any input is helping me put that 3-year-question to rest : )
Sent from my SM-G950U using Tapatalk
-
-
No HGW.
When combined with Mojave, HGW makes a somewhat SoulSucker-looking animal. Very strong dorsal stripe and reduction of lateral pattern
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|