Any possibility of bug eye?? Can anyone explain its genetics?
I cannot see your pics Leucistics of any species have a tendency toward bug-eyes, it is an inherent side effect of the mutation
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
Bogertophis (07-29-2020)
I had a pay for these years ago and one of them had bug eyes .. I bought one and the breeder gave me the bug eye for free I think it’s just part of their genetics ? Seems fairly common with them anyways Sent from my iPhone using Tapatalk Pro
Forum Rules